Transcript: Mouse NM_027972.1

Mus musculus cilia and flagella associated protein 45 (Cfap45), mRNA.

Source:
NCBI, updated 2016-06-24
Taxon:
Mus musculus (mouse)
Gene:
Cfap45 (71870)
Length:
1822
CDS:
50..1705

Additional Resources:

NCBI RefSeq record:
NM_027972.1
NBCI Gene record:
Cfap45 (71870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346714 CACATCGTGGAGCAGATAAAG pLKO_005 827 CDS 100% 13.200 9.240 N Cfap45 n/a
2 TRCN0000346715 CAGGAGAAGGCGCAGGATTAT pLKO_005 1175 CDS 100% 13.200 9.240 N Cfap45 n/a
3 TRCN0000157217 GCTCAAGGACATGAGCAAGAT pLKO.1 619 CDS 100% 0.495 0.347 N CFAP45 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11767 pDONR223 100% 72.7% 72.7% None (many diffs) n/a
2 ccsbBroad304_11767 pLX_304 0% 72.7% 72.7% V5 (many diffs) n/a
3 TRCN0000481570 CCAGTCGGGTCCAAGCTGCGTTGT pLX_317 33.2% 72.7% 72.7% V5 (many diffs) n/a
Download CSV