Transcript: Mouse NM_183138.2

Mus musculus tet methylcytosine dioxygenase 3 (Tet3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Tet3 (194388)
Length:
10907
CDS:
232..5238

Additional Resources:

NCBI RefSeq record:
NM_183138.2
NBCI Gene record:
Tet3 (194388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375394 GCTCCAACGAGAAGCTATTTG pLKO_005 4610 CDS 100% 13.200 18.480 N Tet3 n/a
2 TRCN0000375393 CTGATACCCTCCGGAAGTATG pLKO_005 2681 CDS 100% 10.800 15.120 N Tet3 n/a
3 TRCN0000246260 GAACCTTCTCTTGCGCTATTT pLKO_005 1828 CDS 100% 13.200 10.560 N TET3 n/a
4 TRCN0000376843 GAACCTTCTCTTGCGCTATTT pLKO_005 1828 CDS 100% 13.200 10.560 N Tet3 n/a
5 TRCN0000366564 TACCTAGACACACCTACTAAG pLKO_005 2263 CDS 100% 0.000 0.000 N Tet3 n/a
6 TRCN0000376789 GAAAGATGAAGGCCCATATTA pLKO_005 2358 CDS 100% 15.000 10.500 N Tet3 n/a
7 TRCN0000366499 CGCCCACAAGGACCAACATAA pLKO_005 3075 CDS 100% 13.200 9.240 N Tet3 n/a
8 TRCN0000375340 CTTCTTGGAGTCACCTCTAAA pLKO_005 2241 CDS 100% 13.200 9.240 N Tet3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14428 pDONR223 100% 49% 25.1% None (many diffs) n/a
2 ccsbBroad304_14428 pLX_304 0% 49% 25.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV