Transcript: Human NM_001009570.2

Homo sapiens chaperonin containing TCP1 subunit 7 (CCT7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
CCT7 (10574)
Length:
1336
CDS:
144..1163

Additional Resources:

NCBI RefSeq record:
NM_001009570.2
NBCI Gene record:
CCT7 (10574)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001009570.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149865 GCCAAAGTTGTCTTGTCCAAA pLKO.1 387 CDS 100% 4.950 3.465 N CCT7 n/a
2 TRCN0000281277 GCCAAAGTTGTCTTGTCCAAA pLKO_005 387 CDS 100% 4.950 3.465 N CCT7 n/a
3 TRCN0000149108 GCTGAGTGGAACATTCTCTAT pLKO.1 336 CDS 100% 4.950 3.465 N CCT7 n/a
4 TRCN0000281354 GCTGAGTGGAACATTCTCTAT pLKO_005 336 CDS 100% 4.950 3.465 N CCT7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001009570.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07641 pDONR223 100% 62.3% 62% None 0_1ins579;5_6ins33;699A>T n/a
2 ccsbBroad304_07641 pLX_304 0% 62.3% 62% V5 0_1ins579;5_6ins33;699A>T n/a
3 TRCN0000466543 TTCTGTAACGCGAACGGGTCCGGC pLX_317 23.1% 62.3% 62% V5 0_1ins579;5_6ins33;699A>T n/a
Download CSV