Transcript: Human NR_030774.1

Homo sapiens uracil phosphoribosyltransferase homolog (UPRT), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
UPRT (139596)
Length:
2570
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_030774.1
NBCI Gene record:
UPRT (139596)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_030774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425135 GCTGTCGATCCATACGAATTG pLKO_005 847 3UTR 100% 10.800 15.120 N UPRT n/a
2 TRCN0000431473 GAGGCAATGGAACAAGGTTTA pLKO_005 819 3UTR 100% 10.800 8.640 N UPRT n/a
3 TRCN0000151616 GACACAAAGAGCCAAAGTATA pLKO.1 896 3UTR 100% 13.200 9.240 N UPRT n/a
4 TRCN0000423574 GCACTGGAAATACTGTAATTG pLKO_005 979 3UTR 100% 13.200 9.240 N UPRT n/a
5 TRCN0000413187 ATGGTGCCAAATCAATCATTC pLKO_005 1075 3UTR 100% 10.800 7.560 N UPRT n/a
6 TRCN0000421399 TGCCTATGAATGATCAGATAC pLKO_005 534 3UTR 100% 10.800 7.560 N UPRT n/a
7 TRCN0000155595 CCTGTCACAACCAGCAAGTAA pLKO.1 231 3UTR 100% 5.625 3.938 N UPRT n/a
8 TRCN0000446179 ACCACTCCAACAGGGTACAAG pLKO_005 741 3UTR 100% 4.950 3.465 N UPRT n/a
9 TRCN0000150589 GCTCTACTAAGGTTTCACATA pLKO.1 1568 3UTR 100% 4.950 3.465 N UPRT n/a
10 TRCN0000154809 GCTGGATTTCATGGCCAGTAA pLKO.1 1985 3UTR 100% 4.950 3.465 N UPRT n/a
11 TRCN0000151418 GTACAAGTATGAAGGAGTGAA pLKO.1 755 3UTR 100% 4.950 3.465 N UPRT n/a
12 TRCN0000423196 GTTCAACCCAGTGTTATCATC pLKO_005 1029 3UTR 100% 4.950 2.970 N UPRT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_030774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09583 pDONR223 100% 36% None (many diffs) n/a
2 ccsbBroad304_09583 pLX_304 0% 36% V5 (many diffs) n/a
3 TRCN0000465960 GTAATTTTCATGTTATTGAATACA pLX_317 33.3% 36% V5 (many diffs) n/a
Download CSV