Transcript: Mouse NM_133198.2

Mus musculus liver glycogen phosphorylase (Pygl), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pygl (110095)
Length:
2821
CDS:
101..2653

Additional Resources:

NCBI RefSeq record:
NM_133198.2
NBCI Gene record:
Pygl (110095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133198.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250696 TATGGCTACGGCATTCGTTAT pLKO_005 566 CDS 100% 10.800 15.120 N Pygl n/a
2 TRCN0000250697 ATCGTGAAGACCCAAGTATTC pLKO_005 1487 CDS 100% 10.800 8.640 N Pygl n/a
3 TRCN0000250699 CTTATTCAATGACTTCTTATG pLKO_005 2669 3UTR 100% 10.800 8.640 N Pygl n/a
4 TRCN0000200634 CCAGACAAGTTCCAGAATAAA pLKO.1 1529 CDS 100% 15.000 10.500 N Pygl n/a
5 TRCN0000250698 CTCGACACTTGGAGATCATTT pLKO_005 1293 CDS 100% 13.200 9.240 N Pygl n/a
6 TRCN0000250695 GTGTCCCAAGAGGGTGTATTA pLKO_005 334 CDS 100% 13.200 9.240 N Pygl n/a
7 TRCN0000191315 CAATGACTTCTTATGGAACTT pLKO.1 2675 3UTR 100% 4.950 3.465 N Pygl n/a
8 TRCN0000119083 CCAGGATATCACATGGCCAAA pLKO.1 1934 CDS 100% 4.050 2.835 N PYGL n/a
9 TRCN0000307008 CCAGGATATCACATGGCCAAA pLKO_005 1934 CDS 100% 4.050 2.835 N PYGL n/a
10 TRCN0000119085 CCTATGTCAAGTGTCAAGATA pLKO.1 2439 CDS 100% 5.625 3.938 N PYGL n/a
11 TRCN0000119082 GCCTATGTCAAGTGTCAAGAT pLKO.1 2438 CDS 100% 4.950 3.465 N PYGL n/a
12 TRCN0000307010 GCCTATGTCAAGTGTCAAGAT pLKO_005 2438 CDS 100% 4.950 3.465 N PYGL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133198.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01355 pDONR223 100% 88.7% 94.5% None (many diffs) n/a
2 ccsbBroad304_01355 pLX_304 0% 88.7% 94.5% V5 (many diffs) n/a
3 TRCN0000477544 TTAGAGCATCTCGACTCCTCAAGG pLX_317 20.6% 88.7% 94.5% V5 (many diffs) n/a
Download CSV