Transcript: Human NM_198128.2

Homo sapiens ring finger protein 138 (RNF138), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
RNF138 (51444)
Length:
3016
CDS:
172..627

Additional Resources:

NCBI RefSeq record:
NM_198128.2
NBCI Gene record:
RNF138 (51444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296488 GTCCTACACCGAAGATGATTT pLKO_005 198 CDS 100% 13.200 9.240 N RNF138 n/a
2 TRCN0000296430 TTTGAACGATGTGATTGATAT pLKO_005 1003 3UTR 100% 13.200 9.240 N RNF138 n/a
3 TRCN0000033837 GCTAGATGAAGAAACCCAATA pLKO.1 567 CDS 100% 10.800 6.480 N RNF138 n/a
4 TRCN0000289971 GCTAGATGAAGAAACCCAATA pLKO_005 567 CDS 100% 10.800 6.480 N RNF138 n/a
5 TRCN0000033834 CCCTGTGTCAAGAATCAAATT pLKO.1 368 CDS 100% 13.200 6.600 Y RNF138 n/a
6 TRCN0000289973 CCCTGTGTCAAGAATCAAATT pLKO_005 368 CDS 100% 13.200 6.600 Y RNF138 n/a
7 TRCN0000033836 CCTAGCCAGATTACCAGAAAT pLKO.1 487 CDS 100% 13.200 6.600 Y RNF138 n/a
8 TRCN0000289899 CCTAGCCAGATTACCAGAAAT pLKO_005 487 CDS 100% 13.200 6.600 Y RNF138 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03309 pDONR223 100% 61.6% 61.6% None 110_111ins282 n/a
2 ccsbBroad304_03309 pLX_304 0% 61.6% 61.6% V5 110_111ins282 n/a
3 TRCN0000471271 AACGGCGGTGCTAGGCGGGGCCCA pLX_317 53.5% 61.6% 61.6% V5 110_111ins282 n/a
Download CSV