Transcript: Human NM_001199163.1

Homo sapiens proteasome 26S subunit, ATPase 5 (PSMC5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
PSMC5 (5705)
Length:
1507
CDS:
241..1437

Additional Resources:

NCBI RefSeq record:
NM_001199163.1
NBCI Gene record:
PSMC5 (5705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020259 GCACAGAGGAACGAACTAAAT pLKO.1 355 CDS 100% 13.200 9.240 N PSMC5 n/a
2 TRCN0000020260 CAAGGTTATCATGGCTACTAA pLKO.1 1083 CDS 100% 5.625 3.938 N PSMC5 n/a
3 TRCN0000352809 CAAGGTTATCATGGCTACTAA pLKO_005 1083 CDS 100% 5.625 3.938 N PSMC5 n/a
4 TRCN0000020262 CAAACAGATCAAGGAGATCAA pLKO.1 681 CDS 100% 4.950 3.465 N PSMC5 n/a
5 TRCN0000343105 CAAACAGATCAAGGAGATCAA pLKO_005 681 CDS 100% 4.950 3.465 N PSMC5 n/a
6 TRCN0000020261 GAAGATTCATTCTCGGAAGAT pLKO.1 1203 CDS 100% 4.950 3.465 N PSMC5 n/a
7 TRCN0000343107 GAAGATTCATTCTCGGAAGAT pLKO_005 1203 CDS 100% 4.950 3.465 N PSMC5 n/a
8 TRCN0000020263 TGCTCCATCTATCATCTTCAT pLKO.1 939 CDS 100% 4.950 3.465 N PSMC5 n/a
9 TRCN0000343106 TGCTCCATCTATCATCTTCAT pLKO_005 939 CDS 100% 4.950 3.465 N PSMC5 n/a
10 TRCN0000065772 GCTCTGAACTGGTACAGAAAT pLKO.1 863 CDS 100% 13.200 7.920 N Psmc5 n/a
11 TRCN0000301559 GCTCTGAACTGGTACAGAAAT pLKO_005 863 CDS 100% 13.200 7.920 N Psmc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01317 pDONR223 100% 98% 98% None 0_1ins24 n/a
2 ccsbBroad304_01317 pLX_304 0% 98% 98% V5 0_1ins24 n/a
3 TRCN0000465850 AGTTCACTATCAATGTATGGCTTT pLX_317 32.9% 97.9% 97.7% V5 0_1ins24;1194G>C n/a
Download CSV