Transcript: Mouse NM_001195774.1

Mus musculus G protein-coupled receptor, family C, group 5, member B (Gprc5b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gprc5b (64297)
Length:
2558
CDS:
174..1409

Additional Resources:

NCBI RefSeq record:
NM_001195774.1
NBCI Gene record:
Gprc5b (64297)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001195774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028211 CCGTTCAGAAGCAATGTGTAT pLKO.1 1302 CDS 100% 4.950 6.930 N Gprc5b n/a
2 TRCN0000028208 GCCACCATATTGGGACTATAA pLKO.1 1964 3UTR 100% 13.200 9.240 N Gprc5b n/a
3 TRCN0000028184 CCTGACGTTTGCCTTCATCAT pLKO.1 497 CDS 100% 4.950 3.465 N Gprc5b n/a
4 TRCN0000028206 GCCTTCTCAATGGATGAACAT pLKO.1 1176 CDS 100% 4.950 3.465 N Gprc5b n/a
5 TRCN0000028194 CCCTTCATCAAGGACAAGGAA pLKO.1 417 CDS 100% 3.000 2.100 N Gprc5b n/a
6 TRCN0000008985 ACCATGTACCTCTTCGGCAAT pLKO.1 927 CDS 100% 4.050 3.240 N GPRC5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03368 pDONR223 100% 82.1% 82.2% None (many diffs) n/a
2 ccsbBroad304_03368 pLX_304 0% 82.1% 82.2% V5 (many diffs) n/a
3 TRCN0000473517 ACTTGCAAGCTACGAAACAAAGAC pLX_317 38.4% 82.1% 82.2% V5 (many diffs) n/a
4 TRCN0000488504 AGTCAATCGTTTACCATTGTGTTG pLX_317 26.2% 82.1% 82.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV