Transcript: Mouse NM_001204274.1

Mus musculus LSM2 homolog, U6 small nuclear RNA and mRNA degradation associated (Lsm2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Lsm2 (27756)
Length:
713
CDS:
230..454

Additional Resources:

NCBI RefSeq record:
NM_001204274.1
NBCI Gene record:
Lsm2 (27756)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001204274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294935 TAGTCGTGGAACTCAAGAATG pLKO_005 273 CDS 100% 10.800 15.120 N Lsm2 n/a
2 TRCN0000123801 GACCAGTACCTCAATATCAAA pLKO.1 326 CDS 100% 5.625 7.875 N Lsm2 n/a
3 TRCN0000123799 CCCAATACTTAAGGTGTGTTT pLKO.1 443 CDS 100% 4.950 6.930 N Lsm2 n/a
4 TRCN0000287415 CCCAATACTTAAGGTGTGTTT pLKO_005 443 CDS 100% 4.950 6.930 N Lsm2 n/a
5 TRCN0000123803 CCTCAATATCAAACTAACCGA pLKO.1 334 CDS 100% 0.750 0.525 N Lsm2 n/a
6 TRCN0000287409 CCTCAATATCAAACTAACCGA pLKO_005 334 CDS 100% 0.750 0.525 N Lsm2 n/a
7 TRCN0000074679 CCCTGAGAAATACCCTCACAT pLKO.1 370 CDS 100% 4.950 3.465 N LSM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03853 pDONR223 100% 68.2% 57.5% None (many diffs) n/a
2 ccsbBroad304_03853 pLX_304 0% 68.2% 57.5% V5 (many diffs) n/a
3 TRCN0000465449 CCCTTGGCCACCCGTCCCCTTTTA pLX_317 80.6% 68.2% 57.5% V5 (many diffs) n/a
Download CSV