Transcript: Mouse NM_001177628.2

Mus musculus solute carrier family 45, member 3 (Slc45a3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Slc45a3 (212980)
Length:
3267
CDS:
362..2023

Additional Resources:

NCBI RefSeq record:
NM_001177628.2
NBCI Gene record:
Slc45a3 (212980)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329432 CAGGTGTTCCTGCCCAAATAC pLKO_005 1583 CDS 100% 13.200 10.560 N Slc45a3 n/a
2 TRCN0000329499 CAAGAACGACTTGGCCAAATA pLKO_005 1993 CDS 100% 13.200 9.240 N Slc45a3 n/a
3 TRCN0000353558 CTTGGGTCTGGTCGCCATTTA pLKO_005 1948 CDS 100% 13.200 9.240 N Slc45a3 n/a
4 TRCN0000329433 CTAAGGCAGTGAGGTGTATTG pLKO_005 2136 3UTR 100% 10.800 7.560 N Slc45a3 n/a
5 TRCN0000329498 GAATTGTGTAAGGCATCAAAG pLKO_005 2023 CDS 100% 10.800 7.560 N Slc45a3 n/a
6 TRCN0000125085 CCAGGTGTGCTTTACTCCATT pLKO.1 769 CDS 100% 4.950 3.465 N Slc45a3 n/a
7 TRCN0000125084 CGGGCAATCTCTTCATCCTAA pLKO.1 2785 3UTR 100% 4.950 3.465 N Slc45a3 n/a
8 TRCN0000125087 CACACTGTTCTACACGGACTT pLKO.1 1225 CDS 100% 4.050 2.835 N Slc45a3 n/a
9 TRCN0000116216 CGCCATTTACTTTGCTACACA pLKO.1 1960 CDS 100% 3.000 2.100 N SLC45A3 n/a
10 TRCN0000125088 GAGACACTATGATGAAGGCAT pLKO.1 1303 CDS 100% 2.640 1.848 N Slc45a3 n/a
11 TRCN0000125086 GAGACCCTTTATCTGGGCTTT pLKO.1 616 CDS 100% 4.050 2.430 N Slc45a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09263 pDONR223 100% 87.4% 90.7% None (many diffs) n/a
2 ccsbBroad304_09263 pLX_304 0% 87.4% 90.7% V5 (many diffs) n/a
3 TRCN0000480458 TTAGCATACGCAGACGGGTGTTGC pLX_317 20.5% 87.4% 90.7% V5 (many diffs) n/a
Download CSV