Transcript: Mouse NM_178633.3

Mus musculus kelch-like 2, Mayven (Klhl2), mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Klhl2 (77113)
Length:
3319
CDS:
267..2048

Additional Resources:

NCBI RefSeq record:
NM_178633.3
NBCI Gene record:
Klhl2 (77113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178633.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108747 GCGTGCAAAGATTACCTCATT pLKO.1 1074 CDS 100% 4.950 6.930 N Klhl2 n/a
2 TRCN0000302996 GCGTGCAAAGATTACCTCATT pLKO_005 1074 CDS 100% 4.950 6.930 N Klhl2 n/a
3 TRCN0000108748 CAGCTTAATCTCCAGTGATAA pLKO.1 875 CDS 100% 13.200 9.240 N Klhl2 n/a
4 TRCN0000303069 CAGCTTAATCTCCAGTGATAA pLKO_005 875 CDS 100% 13.200 9.240 N Klhl2 n/a
5 TRCN0000108746 CCAGTGATAAACTCACCATTT pLKO.1 886 CDS 100% 10.800 7.560 N Klhl2 n/a
6 TRCN0000315537 CCAGTGATAAACTCACCATTT pLKO_005 886 CDS 100% 10.800 7.560 N Klhl2 n/a
7 TRCN0000108745 GCCTCGAATGACTATGGATTA pLKO.1 2342 3UTR 100% 10.800 7.560 N Klhl2 n/a
8 TRCN0000303070 GCCTCGAATGACTATGGATTA pLKO_005 2342 3UTR 100% 10.800 7.560 N Klhl2 n/a
9 TRCN0000108749 GCAGTTAATGGTCTGTTGTAT pLKO.1 1884 CDS 100% 5.625 3.938 N Klhl2 n/a
10 TRCN0000302997 GCAGTTAATGGTCTGTTGTAT pLKO_005 1884 CDS 100% 5.625 3.938 N Klhl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178633.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07792 pDONR223 100% 88.7% 98.6% None (many diffs) n/a
2 ccsbBroad304_07792 pLX_304 0% 88.7% 98.6% V5 (many diffs) n/a
3 TRCN0000467596 TTCATGAAGCTCCGCGGTCAGTTA pLX_317 25.2% 88.7% 98.6% V5 (many diffs) n/a
Download CSV