Transcript: Mouse NM_009634.6

Mus musculus adenylosuccinate lyase (Adsl), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Adsl (11564)
Length:
3712
CDS:
59..1513

Additional Resources:

NCBI RefSeq record:
NM_009634.6
NBCI Gene record:
Adsl (11564)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009634.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339619 GACAATACGGACCTGATTATT pLKO_005 407 CDS 100% 15.000 21.000 N Adsl n/a
2 TRCN0000120128 CGGACCTGATTATTCTGAGAA pLKO.1 414 CDS 100% 4.950 6.930 N Adsl n/a
3 TRCN0000339620 TCTCACTGCAGATACTATATT pLKO_005 1093 CDS 100% 15.000 10.500 N Adsl n/a
4 TRCN0000120131 CCTGCTATGTCGGAGACAATA pLKO.1 393 CDS 100% 13.200 9.240 N Adsl n/a
5 TRCN0000120129 CCGCGAGATGTGTTTCTTGTT pLKO.1 127 CDS 100% 4.950 3.465 N Adsl n/a
6 TRCN0000339690 CCGCGAGATGTGTTTCTTGTT pLKO_005 127 CDS 100% 4.950 3.465 N Adsl n/a
7 TRCN0000120130 GACCTGATTATTCTGAGAAAT pLKO.1 416 CDS 100% 13.200 7.920 N Adsl n/a
8 TRCN0000201143 CCAAAGGTCCTGAGTTCAAAT pLKO.1 1754 3UTR 100% 13.200 6.600 Y Ptcra n/a
9 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 1762 3UTR 100% 2.640 1.320 Y Adsl n/a
10 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 1762 3UTR 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009634.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00032 pDONR223 100% 86.7% 94% None (many diffs) n/a
2 ccsbBroad304_00032 pLX_304 0% 86.7% 94% V5 (many diffs) n/a
3 TRCN0000470493 GCACGTTTTCGAGCTATGTGGATG pLX_317 36% 86.7% 94% V5 (many diffs) n/a
Download CSV