Transcript: Mouse NM_001289443.1

Mus musculus tyrosine kinase, non-receptor, 2 (Tnk2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Tnk2 (51789)
Length:
2721
CDS:
342..1898

Additional Resources:

NCBI RefSeq record:
NM_001289443.1
NBCI Gene record:
Tnk2 (51789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023751 GAGACCAATTACGCCTTTGTA pLKO.1 870 CDS 100% 5.625 7.875 N Tnk2 n/a
2 TRCN0000023750 GCCTCTACAGAATAGCTTCAT pLKO.1 239 5UTR 100% 4.950 3.960 N Tnk2 n/a
3 TRCN0000322227 GCCTCTACAGAATAGCTTCAT pLKO_005 239 5UTR 100% 4.950 3.960 N Tnk2 n/a
4 TRCN0000023752 CCTAAGTATGCCACTCCACAA pLKO.1 1344 CDS 100% 4.050 3.240 N Tnk2 n/a
5 TRCN0000350731 CCTAAGTATGCCACTCCACAA pLKO_005 1344 CDS 100% 4.050 3.240 N Tnk2 n/a
6 TRCN0000322165 GTAGGACCCTTCCCTCGAAAT pLKO_005 174 5UTR 100% 10.800 7.560 N Tnk2 n/a
7 TRCN0000322228 TGTGGAGTGTTGGACAGAATG pLKO_005 2382 3UTR 100% 10.800 7.560 N Tnk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488774 ATCGAATTATCCTTTTGCTGGTCT pLX_317 11.4% 42.7% 45.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV