Transcript: Mouse NM_001277221.1

Mus musculus v-crk avian sarcoma virus CT10 oncogene homolog (Crk), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Crk (12928)
Length:
5469
CDS:
166..414

Additional Resources:

NCBI RefSeq record:
NM_001277221.1
NBCI Gene record:
Crk (12928)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001277221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042604 GCTGGTAAAGGTTACGAAGAT pLKO.1 415 CDS 100% 4.950 6.930 N Crk n/a
2 TRCN0000321846 CTGTATGAGAAGACGTAAATA pLKO_005 782 3UTR 100% 15.000 12.000 N Crk n/a
3 TRCN0000321842 TGGTAAAGGTTACGAAGATTA pLKO_005 417 3UTR 100% 13.200 9.240 N Crk n/a
4 TRCN0000321784 GAGGACTTCAGCTGAGTATAG pLKO_005 530 3UTR 100% 10.800 7.560 N Crk n/a
5 TRCN0000042606 CTGGATCAACAGAATCCCGAT pLKO.1 509 3UTR 100% 2.160 1.512 N Crk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15388 pDONR223 0% 37.5% 39.7% None (many diffs) n/a
2 ccsbBroadEn_06038 pDONR223 100% 25.3% 26.6% None (many diffs) n/a
3 ccsbBroad304_06038 pLX_304 0% 25.3% 26.6% V5 (many diffs) n/a
4 TRCN0000469357 TGTCATACTTCCAAGAGTACCAAC pLX_317 46% 25.3% 26.6% V5 (many diffs) n/a
Download CSV