Transcript: Mouse NM_001301343.1

Mus musculus heterogeneous nuclear ribonucleoprotein K (Hnrnpk), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpk (15387)
Length:
2839
CDS:
134..1528

Additional Resources:

NCBI RefSeq record:
NM_001301343.1
NBCI Gene record:
Hnrnpk (15387)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096825 CGGATTAAACAAATTCGTCAT pLKO.1 1358 CDS 100% 4.050 5.670 N Hnrnpk n/a
2 TRCN0000096827 CAGTGCTGATATTGAGACGAT pLKO.1 403 CDS 100% 2.640 3.696 N Hnrnpk n/a
3 TRCN0000096824 CCTTACTTTGTGGTCACTGTA pLKO.1 1869 3UTR 100% 4.950 3.960 N Hnrnpk n/a
4 TRCN0000295993 AGATTTGGCTGGATCTATTAT pLKO_005 1321 CDS 100% 15.000 10.500 N HNRNPK n/a
5 TRCN0000096828 AGGAGGAATAATTGGTGTTAA pLKO.1 601 CDS 100% 13.200 9.240 N Hnrnpk n/a
6 TRCN0000295994 CAGATGTTGAAGGATTCTAAT pLKO_005 1509 CDS 100% 13.200 9.240 N HNRNPK n/a
7 TRCN0000096826 CCAAAGATTTGGCTGGATCTA pLKO.1 1317 CDS 100% 4.950 3.465 N Hnrnpk n/a
8 TRCN0000062454 TGCCAGTGTTTCAGTCCCAGA pLKO.1 352 CDS 100% 2.160 1.512 N HNRNPK n/a
9 TRCN0000062455 GCCAGTGTTTCAGTCCCAGAC pLKO.1 353 CDS 100% 0.750 0.450 N HNRNPK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00768 pDONR223 100% 93.9% 100% None (many diffs) n/a
2 ccsbBroad304_00768 pLX_304 0% 93.9% 100% V5 (many diffs) n/a
3 TRCN0000468412 CCCCATTGTATATAGATTGTGAAT pLX_317 32.5% 93.9% 100% V5 (many diffs) n/a
4 ccsbBroadEn_06391 pDONR223 100% 93% 98.7% None (many diffs) n/a
5 ccsbBroad304_06391 pLX_304 0% 93% 98.7% V5 (many diffs) n/a
6 TRCN0000468999 AGATGCTGATCGCCCCCACGGCCG pLX_317 31.7% 93% 98.7% V5 (many diffs) n/a
Download CSV