Transcript: Mouse NM_009770.3

Mus musculus B cell translocation gene 3 (Btg3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Btg3 (12228)
Length:
1414
CDS:
217..975

Additional Resources:

NCBI RefSeq record:
NM_009770.3
NBCI Gene record:
Btg3 (12228)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247847 GAAGACATACCTTCCTATATA pLKO_005 1012 3UTR 100% 15.000 7.500 Y Btg3 n/a
2 TRCN0000215623 GACCGAAATCACTGGATTAAT pLKO.1 931 CDS 100% 15.000 7.500 Y Btg3 n/a
3 TRCN0000247849 GACCGAAATCACTGGATTAAT pLKO_005 931 CDS 100% 15.000 7.500 Y Btg3 n/a
4 TRCN0000247845 CAGATTTCAGAACTGATATTC pLKO_005 733 CDS 100% 13.200 6.600 Y Btg3 n/a
5 TRCN0000217498 GGACGAGAACAAGGATGAAAT pLKO.1 576 CDS 100% 13.200 6.600 Y Btg3 n/a
6 TRCN0000247846 ATAAACCATTCCGCCCAATTC pLKO_005 875 CDS 100% 10.800 5.400 Y Btg3 n/a
7 TRCN0000247848 GCAAGGAAGTGGACGTGAAAC pLKO_005 677 CDS 100% 10.800 5.400 Y Btg3 n/a
8 TRCN0000184242 GCGATGTGTTCTAGCACCTTT pLKO.1 1269 3UTR 100% 4.950 2.475 Y Btg3 n/a
9 TRCN0000183257 GTCAATAAGTTTCAGAGAGTT pLKO.1 400 CDS 100% 4.950 2.475 Y Btg3 n/a
10 TRCN0000117853 CCAGGAATGTATCGAGGGAAT pLKO.1 793 CDS 100% 4.050 2.025 Y BTG3 n/a
11 TRCN0000300858 CCAGGAATGTATCGAGGGAAT pLKO_005 793 CDS 100% 4.050 2.025 Y BTG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02569 pDONR223 100% 77.9% 80% None (many diffs) n/a
2 ccsbBroad304_02569 pLX_304 0% 77.9% 80% V5 (many diffs) n/a
3 TRCN0000470746 TACCCCCTCCAAGTATCTCAAATC pLX_317 47.1% 77.9% 80% V5 (many diffs) n/a
Download CSV