Transcript: Mouse NM_178725.6

Mus musculus leucine rich repeat containing 4C (Lrrc4c), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Lrrc4c (241568)
Length:
3492
CDS:
859..2781

Additional Resources:

NCBI RefSeq record:
NM_178725.6
NBCI Gene record:
Lrrc4c (241568)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178725.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108459 CCTTGAATGTTACTGCGGCAA pLKO.1 2177 CDS 100% 2.160 3.024 N Lrrc4c n/a
2 TRCN0000108457 CCGAATGAACTCTAAAGACAA pLKO.1 2739 CDS 100% 4.950 3.465 N Lrrc4c n/a
3 TRCN0000160498 CCGAATGAACTCTAAAGACAA pLKO.1 2739 CDS 100% 4.950 3.465 N LRRC4C n/a
4 TRCN0000108458 CCCAGGAATTGATGAGGTCAT pLKO.1 2406 CDS 100% 4.050 2.835 N Lrrc4c n/a
5 TRCN0000108456 GCACTTAGAAATCCTCCAGTT pLKO.1 1158 CDS 100% 4.050 2.835 N Lrrc4c n/a
6 TRCN0000160849 GAGGTATTTGAACCTTGCCAT pLKO.1 1455 CDS 100% 2.640 1.848 N LRRC4C n/a
7 TRCN0000108455 GCCCTTATGAAATAGTCAAAT pLKO.1 3211 3UTR 100% 13.200 6.600 Y Lrrc4c n/a
8 TRCN0000160566 CAACAAGGACTGTTGAAATTA pLKO.1 2543 CDS 100% 1.500 1.050 N LRRC4C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178725.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10463 pDONR223 100% 92.5% 99% None (many diffs) n/a
2 ccsbBroad304_10463 pLX_304 0% 92.5% 99% V5 (many diffs) n/a
3 TRCN0000492330 GGCAGCCTCATTCGGAGGATCGTC pLX_317 21.7% 92.5% 99% V5 (many diffs) n/a
Download CSV