Construct: ORF TRCN0000492330
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005824.1_s317c1
- Derived from:
- ccsbBroadEn_10463
- DNA Barcode:
- GGCAGCCTCATTCGGAGGATCGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRRC4C (57689)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492330
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57689 | LRRC4C | leucine rich repeat contain... | NM_001258419.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 2 | human | 57689 | LRRC4C | leucine rich repeat contain... | NM_020929.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 3 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_011520238.3 | 99.3% | 99.3% | 1_12del;963C>G |
| 4 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_011520239.3 | 99.3% | 99.3% | 1_12del;963C>G |
| 5 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_011520240.3 | 99.3% | 99.3% | 1_12del;963C>G |
| 6 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_011520241.3 | 99.3% | 99.3% | 1_12del;963C>G |
| 7 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_011520242.3 | 99.3% | 99.3% | 1_12del;963C>G |
| 8 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_011520243.3 | 99.3% | 99.3% | 1_12del;963C>G |
| 9 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_011520244.3 | 99.3% | 99.3% | 1_12del;963C>G |
| 10 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_017018070.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 11 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_017018071.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 12 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_017018072.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 13 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_017018073.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 14 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_017018074.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 15 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_017018075.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 16 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_017018076.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 17 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_017018077.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 18 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_017018078.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 19 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_017018079.2 | 99.3% | 99.3% | 1_12del;963C>G |
| 20 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_024448626.1 | 99.3% | 99.3% | 1_12del;963C>G |
| 21 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_024448627.1 | 99.3% | 99.3% | 1_12del;963C>G |
| 22 | human | 57689 | LRRC4C | leucine rich repeat contain... | XM_024448628.1 | 99.3% | 99.3% | 1_12del;963C>G |
| 23 | human | 57689 | LRRC4C | leucine rich repeat contain... | NR_047674.1 | 62% | 1_992del;1943C>G;2901_3074del | |
| 24 | human | 57689 | LRRC4C | leucine rich repeat contain... | NR_047673.1 | 60.9% | 1_1045del;1996C>G;2954_3127del | |
| 25 | mouse | 241568 | Lrrc4c | leucine rich repeat contain... | NM_001289742.1 | 92.5% | 99% | (many diffs) |
| 26 | mouse | 241568 | Lrrc4c | leucine rich repeat contain... | NM_001289743.1 | 92.5% | 99% | (many diffs) |
| 27 | mouse | 241568 | Lrrc4c | leucine rich repeat contain... | NM_001289744.1 | 92.5% | 99% | (many diffs) |
| 28 | mouse | 241568 | Lrrc4c | leucine rich repeat contain... | NM_178725.6 | 92.5% | 99% | (many diffs) |
| 29 | mouse | 241568 | Lrrc4c | leucine rich repeat contain... | XM_006499479.3 | 92.5% | 99% | (many diffs) |
| 30 | mouse | 241568 | Lrrc4c | leucine rich repeat contain... | XM_017318139.1 | 92.5% | 99% | (many diffs) |
| 31 | mouse | 241568 | Lrrc4c | leucine rich repeat contain... | XM_017318140.1 | 92.5% | 99% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1974
- ORF length:
- 1908
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac cttacatcca cagcagataa tgataggtcc taggtttaac agggccctat 121 ttgaccccct gcttgtggtg ctgctggctc ttcaacttct tgtggtggct ggtctggtgc 181 gggctcagac ctgcccttct gtgtgctcct gcagcaacca gttcagcaag gtgatttgtg 241 ttcggaaaaa cctgcgtgag gttccggatg gcatctccac caacacacgg ctgctgaacc 301 tccatgagaa ccaaatccag atcatcaaag tgaacagctt caagcacttg agacacttgg 361 aaatcctaca gttgagtagg aaccatatca gaaccattga aattggggct ttcaatggtc 421 tggcgaacct caacactctg gaactctttg acaatcgtct tactaccatc ccgaatggag 481 cttttgtata cttgtctaaa ctgaaggagc tctggttgcg aaacaacccc attgaaagca 541 tcccttctta tgcttttaac agaattcctt ctttgcgccg actagactta ggggaattga 601 aaagactttc atacatctca gaaggtgcct ttgaaggtct gtccaacttg aggtatttga 661 accttgccat gtgcaacctt cgggaaatcc ctaacctcac accgctcata aaactagatg 721 agctggatct ttctgggaat catttatctg ccatcaggcc tggctctttc cagggtttga 781 tgcaccttca aaaactgtgg atgatacagt cccagattca agtgattgaa cggaatgcct 841 ttgacaacct tcagtcacta gtggagatca acctggcaca caataatcta acattactgc 901 ctcatgacct cttcactccc ttgcatcatc tagagcggat acatttacat cacaaccctt 961 ggaactgtaa ctgtgacata ctgtggctca gctggtggat aaaagacatg gccccgtcga 1021 acacagcttg ttgtgcccgg tgtaacactc ctcccaatct aaaggggagg tacattggag 1081 agctcgacca gaattacttc acatgctatg ctccggtgat tgtggagccc cctgcagacc 1141 tcaatgtcac tgaaggcatg gcagctgagc tgaaatgtcg ggcctccaca tccctgacat 1201 ctgtatcttg gattactcca aatggaacag tcatgacaca tggggcgtac aaagtgcgga 1261 tagctgtgct cagtgatggt acgttaaatt tcacaaatgt aactgtgcaa gatacaggca 1321 tgtacacatg tatggtgagt aattccgttg ggaatactac tgcttcagcc accctgaatg 1381 ttactgcagc aaccactact cctttctctt acttttcaac cgtcacagta gagactatgg 1441 aaccgtctca ggatgaggca cggaccacag ataacaatgt gggtcccact ccagtggtcg 1501 actgggagac caccaatgtg accacctctc tcacaccaca gagcacaagg tcgacagaga 1561 aaaccTTCAC CATCCCAGTG ACTGATATAA ACAGTGGGAT CCCAGGAATT GATGAGGTCA 1621 TGAAGACTAC CAAAATCATC ATTGGGTGTT TTGTGGCCAT CACACTCATG GCTGCAGTGA 1681 TGCTGGTCAT TTTCTACAAG ATGAGGAAGC AGCACCATCG GCAAAACCAT CACGCCCCAA 1741 CAAGGACTGT TGAAATTATT AATGTGGATG ATGAGATTAC GGGAGACACA CCCATGGAAA 1801 GCCACCTGCC CATGCCTGCT ATCGAGCATG AGCACCTAAA TCACTATAAC TCATACAAAT 1861 CTCCCTTCAA CCACACAACA ACAGTTAACA CAATAAATTC AATACACAGT TCAGTGCATG 1921 AACCGTTATT GATCCGAATG AACTCTAAAG ACAATGTACA AGAGACTCAA ATCTACCCAA 1981 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 2041 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 2101 TATCTTGTGG AAAGGACGAG GCAGCCTCAT TCGGAGGATC GTCACGCGTT AAGTCgacaa 2161 tcaacctctg gattacaaaa tttgtgaaag att