Transcript: Mouse NM_008741.4

Mus musculus neuron specific gene family member 2 (Nsg2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Nsg2 (18197)
Length:
2308
CDS:
200..715

Additional Resources:

NCBI RefSeq record:
NM_008741.4
NBCI Gene record:
Nsg2 (18197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008741.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104928 ACGCCCTTGGAGGTTAATCAT pLKO.1 284 CDS 100% 5.625 7.875 N Nsg2 n/a
2 TRCN0000104926 GCTGAATTTACGGTCACCATT pLKO.1 401 CDS 100% 4.950 6.930 N Nsg2 n/a
3 TRCN0000158345 CGCTGAATTTACGGTCACCAT pLKO.1 400 CDS 100% 2.640 3.696 N NSG2 n/a
4 TRCN0000434817 TTGTTCCCATGTAAGATATTT pLKO_005 973 3UTR 100% 15.000 10.500 N NSG2 n/a
5 TRCN0000104929 GTGCCAAAGATCGCTGAATTT pLKO.1 389 CDS 100% 13.200 9.240 N Nsg2 n/a
6 TRCN0000104925 CCGGGAAGAAACTTGAAGATT pLKO.1 1662 3UTR 100% 5.625 3.938 N Nsg2 n/a
7 TRCN0000104927 CCTGGTGGTTTACAAAGCCTT pLKO.1 463 CDS 100% 2.640 1.848 N Nsg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008741.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03346 pDONR223 100% 91% 97% None (many diffs) n/a
2 ccsbBroad304_03346 pLX_304 0% 91% 97% V5 (many diffs) n/a
3 TRCN0000468822 TGCATGGTCTAAAATCCACGCGCG pLX_317 73.7% 91% 97% V5 (many diffs) n/a
Download CSV