Transcript: Mouse NM_007389.5

Mus musculus cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) (Chrna1), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Chrna1 (11435)
Length:
4320
CDS:
52..1425

Additional Resources:

NCBI RefSeq record:
NM_007389.5
NBCI Gene record:
Chrna1 (11435)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007389.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102850 GCGATCACATACAAATAGTAT pLKO.1 2492 3UTR 100% 5.625 7.875 N Chrna1 n/a
2 TRCN0000102853 ACAACCAATGTACGTCTGAAA pLKO.1 262 CDS 100% 4.950 6.930 N Chrna1 n/a
3 TRCN0000102854 GACAACCAATGTACGTCTGAA pLKO.1 261 CDS 100% 4.950 6.930 N Chrna1 n/a
4 TRCN0000102851 CGGCTCATTGAGTTACATCAA pLKO.1 1396 CDS 100% 4.950 3.960 N Chrna1 n/a
5 TRCN0000102852 CGACACTATCCCAAACATCAT pLKO.1 1062 CDS 100% 4.950 3.465 N Chrna1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007389.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10733 pDONR223 100% 51.7% 52.1% None (many diffs) n/a
2 ccsbBroad304_10733 pLX_304 0% 51.7% 52.1% V5 (many diffs) n/a
3 TRCN0000471146 TGTAAACCTGCTCGCCGACGTCCG pLX_317 51.9% 51.7% 52.1% V5 (many diffs) n/a
4 TRCN0000491414 CCAACCCCGCAGAATAAGCCCCGA pLX_317 37.2% 51.7% 52.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV