Transcript: Mouse NM_001025093.2

Mus musculus activating transcription factor 2 (Atf2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Atf2 (11909)
Length:
4300
CDS:
424..1887

Additional Resources:

NCBI RefSeq record:
NM_001025093.2
NBCI Gene record:
Atf2 (11909)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001025093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082078 GCGAGCTAACTTGTACTTATT pLKO.1 2879 3UTR 100% 13.200 18.480 N Atf2 n/a
2 TRCN0000218996 GCTATCATACTGCTGATAAAG pLKO_005 1652 CDS 100% 1.320 1.848 N ATF2 n/a
3 TRCN0000082082 CTGGCTATCATACTGCTGATA pLKO.1 1649 CDS 100% 0.495 0.693 N Atf2 n/a
4 TRCN0000374123 ATCGTTCGTCCAGCATCATTA pLKO_005 856 CDS 100% 13.200 10.560 N Atf2 n/a
5 TRCN0000219047 TGCGAAATCTGTGGTTGTAAA pLKO_005 1967 3UTR 100% 13.200 10.560 N ATF2 n/a
6 TRCN0000374121 TGCGAAATCTGTGGTTGTAAA pLKO_005 1967 3UTR 100% 13.200 10.560 N Atf2 n/a
7 TRCN0000365860 ATGGTAGTCTTGTTATCATTT pLKO_005 2266 3UTR 100% 13.200 9.240 N Atf2 n/a
8 TRCN0000365933 GAAGTTTCTAGAACGAAATAG pLKO_005 1437 CDS 100% 13.200 9.240 N Atf2 n/a
9 TRCN0000013713 GCGAAATCTGTGGTTGTAAAT pLKO.1 1968 3UTR 100% 13.200 9.240 N ATF2 n/a
10 TRCN0000365934 TTGCTATTCCTGCATCAATTA pLKO_005 1055 CDS 100% 13.200 9.240 N Atf2 n/a
11 TRCN0000013715 CCATCCTCTAACAGGCCAATT pLKO.1 973 CDS 100% 10.800 7.560 N ATF2 n/a
12 TRCN0000374043 TTCCTGTACCAGGCCCATTTC pLKO_005 995 CDS 100% 10.800 7.560 N Atf2 n/a
13 TRCN0000082079 CCGTTGCTATTCCTGCATCAA pLKO.1 1052 CDS 100% 4.950 3.465 N Atf2 n/a
14 TRCN0000082080 CCTCCAGTTACCAATGGTGAT pLKO.1 1228 CDS 100% 4.050 2.835 N Atf2 n/a
15 TRCN0000082081 GCAGCTAATGAAGATCCTGAT pLKO.1 1405 CDS 100% 4.050 2.835 N Atf2 n/a
16 TRCN0000013714 GCATCATTACAGGTTCCCAAT pLKO.1 868 CDS 100% 4.050 2.835 N ATF2 n/a
17 TRCN0000013717 GCTCATAAAGATTGCCCTGTA pLKO.1 1609 CDS 100% 4.050 2.430 N ATF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00361 pDONR223 100% 91% 95.6% None (many diffs) n/a
2 ccsbBroad304_00361 pLX_304 44.6% 91% 95.6% V5 (many diffs) n/a
3 TRCN0000469368 TCGCTTTTGTCGAGAGAGTTTCCG pLX_317 30.8% 91% 95.6% V5 (many diffs) n/a
4 ccsbBroadEn_10749 pDONR223 100% 36.2% 37.8% None (many diffs) n/a
5 ccsbBroad304_10749 pLX_304 0% 36.2% 37.8% V5 (many diffs) n/a
6 TRCN0000468300 CCCGGTGGTGACCGCTCCGGTCGA pLX_317 57.9% 36.2% 37.8% V5 (many diffs) n/a
Download CSV