Transcript: Mouse NM_007764.5

Mus musculus v-crk avian sarcoma virus CT10 oncogene homolog-like (Crkl), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Crkl (12929)
Length:
5050
CDS:
494..1405

Additional Resources:

NCBI RefSeq record:
NM_007764.5
NBCI Gene record:
Crkl (12929)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007764.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097203 GAATATGTACGGACCCTTTAT pLKO.1 869 CDS 100% 13.200 18.480 N Crkl n/a
2 TRCN0000231358 GCGAGCTTCTAGTGATAATAG pLKO_005 933 CDS 100% 13.200 18.480 N Crkl n/a
3 TRCN0000231359 CCCGATGACAACGAGTGATTG pLKO_005 1388 CDS 100% 10.800 15.120 N Crkl n/a
4 TRCN0000097199 GCCTACATACATACCTTGTAT pLKO.1 2884 3UTR 100% 0.563 0.788 N Crkl n/a
5 TRCN0000097200 CCTGGACACTACCACCTTAAT pLKO.1 769 CDS 100% 13.200 10.560 N Crkl n/a
6 TRCN0000231357 CCTGGACACTACCACCTTAAT pLKO_005 769 CDS 100% 13.200 10.560 N Crkl n/a
7 TRCN0000376981 GCTGAAGACCTACCCTTTAAA pLKO_005 908 CDS 100% 15.000 10.500 N Crkl n/a
8 TRCN0000257255 AGTGAGCAGCTCTAGCATTTA pLKO_005 2610 3UTR 100% 13.200 9.240 N Crkl n/a
9 TRCN0000376980 ACTCTGTCACATGCAAGTTAC pLKO_005 1467 3UTR 100% 10.800 7.560 N Crkl n/a
10 TRCN0000231356 GGACCAGGAGTTTGACCATTT pLKO_005 715 CDS 100% 10.800 7.560 N Crkl n/a
11 TRCN0000097201 GCATTGGAGGTTGGTGACATT pLKO.1 1262 CDS 100% 4.950 3.465 N Crkl n/a
12 TRCN0000324716 GCATTGGAGGTTGGTGACATT pLKO_005 1262 CDS 100% 4.950 3.465 N Crkl n/a
13 TRCN0000097202 CCCAACTTACCTACAGCAGAA pLKO.1 839 CDS 100% 4.050 2.430 N Crkl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007764.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000474193 TGTTATCCATAAATTTTCACTACC pLX_317 48.5% 90.2% 22.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14595 pDONR223 100% 90.1% 22.5% None (many diffs) n/a
3 ccsbBroad304_14595 pLX_304 0% 90.1% 22.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV