Transcript: Human NM_001282326.1

Homo sapiens SMG6 nonsense mediated mRNA decay factor (SMG6), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
SMG6 (23293)
Length:
4243
CDS:
1598..2590

Additional Resources:

NCBI RefSeq record:
NM_001282326.1
NBCI Gene record:
SMG6 (23293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040016 GCTCGAAATCAGACCTTTGTT pLKO.1 2050 CDS 100% 5.625 7.875 N SMG6 n/a
2 TRCN0000010348 CATGAACCCAAGTCGGCTTCT pLKO.1 3122 3UTR 100% 4.050 2.835 N SMG6 n/a
3 TRCN0000040013 GCCAGAGACAAGGACAACTTA pLKO.1 3839 3UTR 100% 5.625 3.375 N SMG6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11713 pDONR223 100% 62.1% 59.6% None (many diffs) n/a
2 ccsbBroad304_11713 pLX_304 0% 62.1% 59.6% V5 (many diffs) n/a
3 TRCN0000466599 TATTGTCTCCGAAAGTGACATGGT pLX_317 24% 62.1% 59.6% V5 (many diffs) n/a
Download CSV