Transcript: Human NM_003702.4

Homo sapiens regulator of G protein signaling 20 (RGS20), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
RGS20 (8601)
Length:
1716
CDS:
145..870

Additional Resources:

NCBI RefSeq record:
NM_003702.4
NBCI Gene record:
RGS20 (8601)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003702.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014306 CCATCCCAACACATATTCGAT pLKO.1 733 CDS 100% 3.000 2.400 N RGS20 n/a
2 TRCN0000014305 GCTCAGTCATTTGACAAATTA pLKO.1 481 CDS 100% 15.000 10.500 N RGS20 n/a
3 TRCN0000415867 CATCTTCTGCTGGAGTAATAC pLKO_005 954 3UTR 100% 13.200 9.240 N RGS20 n/a
4 TRCN0000422167 CATGAACTCTGCTGTCTATAA pLKO_005 807 CDS 100% 13.200 9.240 N RGS20 n/a
5 TRCN0000014303 GCCAACCTAAAGAATGAATTT pLKO.1 1569 3UTR 100% 13.200 9.240 N RGS20 n/a
6 TRCN0000436652 AGAAAGCAAGGATAATCTATG pLKO_005 629 CDS 100% 10.800 7.560 N RGS20 n/a
7 TRCN0000014307 GCTCGTGTCTCACTGTTAGAA pLKO.1 356 CDS 100% 5.625 3.938 N RGS20 n/a
8 TRCN0000014304 CGGAGAAATCTATTGAAGCAT pLKO.1 848 CDS 100% 3.000 2.100 N RGS20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003702.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01965 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01965 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_11282 pDONR223 100% 90% 90% None 1_72del n/a
4 ccsbBroad304_11282 pLX_304 0% 90% 90% V5 1_72del n/a
5 TRCN0000474168 AATTTGACGACATGACATTACAAC pLX_317 78.8% 90% 90% V5 1_72del n/a
Download CSV