Transcript: Human NM_001289978.1

Homo sapiens double PHD fingers 1 (DPF1), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
DPF1 (8193)
Length:
2378
CDS:
28..1302

Additional Resources:

NCBI RefSeq record:
NM_001289978.1
NBCI Gene record:
DPF1 (8193)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231953 CCATTATGGACTGTCAGAAAC pLKO_005 518 CDS 100% 10.800 15.120 N DPF1 n/a
2 TRCN0000231956 TCTCCGAGCTCCTCAATTCTC pLKO_005 1350 3UTR 100% 4.950 6.930 N DPF1 n/a
3 TRCN0000257312 GCGAGTACAAGATCGACTGTG pLKO_005 392 CDS 100% 4.050 5.670 N DPF1 n/a
4 TRCN0000013170 GTGTTTACAATTCACGGTGAA pLKO.1 1017 CDS 100% 4.050 3.240 N DPF1 n/a
5 TRCN0000013168 CCCTCTGTGCAAGTGGAATGT pLKO.1 1440 3UTR 100% 4.950 3.465 N DPF1 n/a
6 TRCN0000013171 GAGTACAAGATCGACTGTGAA pLKO.1 394 CDS 100% 4.950 3.465 N DPF1 n/a
7 TRCN0000231954 GTTGCTGGAGTTTCCGCATGA pLKO_005 543 CDS 100% 4.050 2.835 N DPF1 n/a
8 TRCN0000013172 TGCTTACATCACCCTCACCTA pLKO.1 1281 CDS 100% 2.640 1.584 N DPF1 n/a
9 TRCN0000433398 TTGCTGGAGTTTCCGCATGAT pLKO_005 544 CDS 100% 4.950 6.930 N Dpf1 n/a
10 TRCN0000082139 CCTGCGAGTACAAGATCGATT pLKO.1 389 CDS 100% 4.950 3.465 N Dpf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000473291 GAGTCACCCTCAAGGGCGTCCCCA pLX_317 28.8% 90.4% 90.3% V5 (many diffs) n/a
2 ccsbBroadEn_11259 pDONR223 100% 46.5% 46.6% None (many diffs) n/a
3 ccsbBroad304_11259 pLX_304 0% 46.5% 46.6% V5 (many diffs) n/a
4 TRCN0000477599 CTATCTACGGGGGAGTCACAGTCC pLX_317 35.4% 46.5% 46.6% V5 (many diffs) n/a
Download CSV