Transcript: Human NM_001293627.1

Homo sapiens poly(A) polymerase alpha (PAPOLA), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PAPOLA (10914)
Length:
4539
CDS:
218..2452

Additional Resources:

NCBI RefSeq record:
NM_001293627.1
NBCI Gene record:
PAPOLA (10914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001293627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294190 TGAAGCCAGGAGTACTATTAT pLKO_005 2626 3UTR 100% 15.000 10.500 N PAPOLA n/a
2 TRCN0000053020 GCAGCATCTGTGACCAACATA pLKO.1 1907 CDS 100% 5.625 3.938 N PAPOLA n/a
3 TRCN0000298258 GCAGCATCTGTGACCAACATA pLKO_005 1907 CDS 100% 5.625 3.938 N PAPOLA n/a
4 TRCN0000053021 GCGTACTTACACAGAAACTAA pLKO.1 324 CDS 100% 5.625 3.938 N PAPOLA n/a
5 TRCN0000286909 GCGTACTTACACAGAAACTAA pLKO_005 324 CDS 100% 5.625 3.938 N PAPOLA n/a
6 TRCN0000175526 CTATTGAAACAGCCTGAAGAA pLKO.1 1073 CDS 100% 4.950 3.465 N Papola n/a
7 TRCN0000279185 CTATTGAAACAGCCTGAAGAA pLKO_005 1073 CDS 100% 4.950 3.465 N Papola n/a
8 TRCN0000053018 CCACGTACAATGTGTCCGTTT pLKO.1 1191 CDS 100% 4.050 2.835 N PAPOLA n/a
9 TRCN0000053019 GCTATCAAACTATGGGCCAAA pLKO.1 893 CDS 100% 4.050 2.835 N PAPOLA n/a
10 TRCN0000053022 GCTGTTGAAGAGGCATTCGTA pLKO.1 659 CDS 100% 3.000 2.100 N PAPOLA n/a
11 TRCN0000311748 GCTGTTGAAGAGGCATTCGTA pLKO_005 659 CDS 100% 3.000 2.100 N PAPOLA n/a
12 TRCN0000294191 ACCATCTTATGCCTATAATTA pLKO_005 1146 CDS 100% 15.000 9.000 N PAPOLA n/a
13 TRCN0000279187 TTGCAGGGTAACCGATGAAAT pLKO_005 826 CDS 100% 13.200 7.920 N Papola n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08657 pDONR223 100% 73.1% 71.7% None (many diffs) n/a
2 ccsbBroad304_08657 pLX_304 0% 73.1% 71.7% V5 (many diffs) n/a
3 TRCN0000468084 CTTTTCATCAAGCTAGGAGATCAC pLX_317 24.9% 73.1% 71.7% V5 (many diffs) n/a
4 ccsbBroadEn_11570 pDONR223 100% 38.1% 37.2% None (many diffs) n/a
5 TRCN0000479225 GTACAGGTACTCAAGTAGGGTTCA pLX_317 64.1% 38.1% 37.2% V5 (many diffs) n/a
Download CSV