Transcript: Human NM_001282150.1

Homo sapiens VPS29 retromer complex component (VPS29), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
VPS29 (51699)
Length:
1296
CDS:
149..793

Additional Resources:

NCBI RefSeq record:
NM_001282150.1
NBCI Gene record:
VPS29 (51699)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304145 ATACCATCTTCTCTGTTAATA pLKO_005 912 3UTR 100% 15.000 10.500 N VPS29 n/a
2 TRCN0000111586 GCCTTGGAAACAAACATTATT pLKO.1 665 CDS 100% 15.000 10.500 N Vps29 n/a
3 TRCN0000287955 GCCTTGGAAACAAACATTATT pLKO_005 665 CDS 100% 15.000 10.500 N Vps29 n/a
4 TRCN0000304146 ACCTATGTGTATCAGCTAATT pLKO_005 728 CDS 100% 13.200 9.240 N VPS29 n/a
5 TRCN0000304147 ATCCATGGACATCAAGTTATT pLKO_005 497 CDS 100% 13.200 9.240 N VPS29 n/a
6 TRCN0000381463 CCCTGTTGCAGAGGCAATTTG pLKO_005 543 CDS 100% 13.200 9.240 N VPS29 n/a
7 TRCN0000078596 CTTTGCACCAAAGAGAGTTAT pLKO.1 362 CDS 100% 13.200 9.240 N VPS29 n/a
8 TRCN0000078595 GCAACAGTTTGCCAGCTAAAT pLKO.1 288 CDS 100% 13.200 9.240 N VPS29 n/a
9 TRCN0000300849 GCAACAGTTTGCCAGCTAAAT pLKO_005 288 CDS 100% 13.200 9.240 N VPS29 n/a
10 TRCN0000078593 GCTTCCTGTAAACTATAAGAA pLKO.1 947 3UTR 100% 5.625 3.938 N VPS29 n/a
11 TRCN0000078597 CCTTTGCACCAAAGAGAGTTA pLKO.1 361 CDS 100% 4.950 3.465 N VPS29 n/a
12 TRCN0000300774 CCTTTGCACCAAAGAGAGTTA pLKO_005 361 CDS 100% 4.950 3.465 N VPS29 n/a
13 TRCN0000379645 GAAAGTAGAACGAATCGAATA pLKO_005 760 CDS 100% 10.800 6.480 N VPS29 n/a
14 TRCN0000078594 CCATCATTTGTGTTGATGGAT pLKO.1 686 CDS 100% 0.300 0.180 N VPS29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03366 pDONR223 100% 86.7% 86.4% None 1_84del;86G>T n/a
2 ccsbBroad304_03366 pLX_304 0% 86.7% 86.4% V5 1_84del;86G>T n/a
3 TRCN0000481468 CTACGTAAACCGGCCGTCGTGACC pLX_317 79.4% 86.7% 86.4% V5 1_84del;86G>T n/a
Download CSV