Transcript: Human NM_001267827.1

Homo sapiens zinc finger protein 839 (ZNF839), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ZNF839 (55778)
Length:
3781
CDS:
351..2786

Additional Resources:

NCBI RefSeq record:
NM_001267827.1
NBCI Gene record:
ZNF839 (55778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142166 GACTTCCGATGGGCTTATCTT pLKO.1 2678 CDS 100% 5.625 7.875 N ZNF839 n/a
2 TRCN0000142683 CTATAGGTGCTGCTCTCTCAT pLKO.1 2071 CDS 100% 4.950 6.930 N ZNF839 n/a
3 TRCN0000144960 GAGTCATTAGGAATCACAGAA pLKO.1 1668 CDS 100% 4.950 6.930 N ZNF839 n/a
4 TRCN0000142243 GAAAGCCATACAACGACGGTT pLKO.1 1974 CDS 100% 2.640 3.696 N ZNF839 n/a
5 TRCN0000143375 GATCACTATTGACTGAAGGGT pLKO.1 2488 CDS 100% 0.750 1.050 N ZNF839 n/a
6 TRCN0000141537 CCCTCCAGTAAATGTGACTGT pLKO.1 1937 CDS 100% 2.640 2.112 N ZNF839 n/a
7 TRCN0000122234 GTTCTGAAGAAAGCCATACAA pLKO.1 1966 CDS 100% 5.625 3.938 N ZNF839 n/a
8 TRCN0000121857 GACATTGTCACAGTGACTGAT pLKO.1 2733 CDS 100% 4.950 3.465 N ZNF839 n/a
9 TRCN0000141679 CCTGGAGAGAATGCTTTGGAA pLKO.1 2172 CDS 100% 3.000 2.100 N ZNF839 n/a
10 TRCN0000141422 CACTGAATCTCTTGCTGCCAA pLKO.1 1862 CDS 100% 2.640 1.848 N ZNF839 n/a
11 TRCN0000143498 GAAATTTCCAATGGGAGCCAT pLKO.1 2619 CDS 100% 2.640 1.848 N ZNF839 n/a
12 TRCN0000142165 GAGCCATGAGTTACTGTCTCA pLKO.1 2633 CDS 100% 2.640 1.848 N ZNF839 n/a
13 TRCN0000142569 GAGGACATTGTCACAGTGACT pLKO.1 2730 CDS 100% 2.640 1.848 N ZNF839 n/a
14 TRCN0000141407 CCAGGAGACCCTGGAAATAAA pLKO.1 1631 CDS 100% 1.500 0.900 N ZNF839 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3563 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3563 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14206 pDONR223 100% 16.3% .7% None (many diffs) n/a
2 ccsbBroad304_14206 pLX_304 0% 16.3% .7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468366 TTAACAATGCGTTCCGCACCAGGG pLX_317 91.8% 16.3% .7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV