Transcript: Human NM_001270451.1

Homo sapiens ubiquitin protein ligase E3B (UBE3B), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
UBE3B (89910)
Length:
1158
CDS:
282..1016

Additional Resources:

NCBI RefSeq record:
NM_001270451.1
NBCI Gene record:
UBE3B (89910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12928 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12928 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469138 CGTAGCACTGTTAGGAGCTACTCA pLX_317 57.5% 100% 100% V5 n/a
4 ccsbBroadEn_09284 pDONR223 100% 21.6% 19.3% None (many diffs) n/a
5 ccsbBroad304_09284 pLX_304 0% 21.6% 19.3% V5 (many diffs) n/a
6 TRCN0000479398 ACTATTTAACACCTTAATACCCGG pLX_317 10.2% 21.6% 19.3% V5 (many diffs) n/a
Download CSV