Transcript: Human NM_001282675.1

Homo sapiens peptidase domain containing associated with muscle regeneration 1 (PAMR1), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
PAMR1 (25891)
Length:
3141
CDS:
557..2599

Additional Resources:

NCBI RefSeq record:
NM_001282675.1
NBCI Gene record:
PAMR1 (25891)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056038 CCTGCCGAGAACCAAAGATTT pLKO.1 1470 CDS 100% 13.200 18.480 N PAMR1 n/a
2 TRCN0000372045 GACGGTTTCCATGCCATTTAT pLKO_005 1115 CDS 100% 15.000 10.500 N PAMR1 n/a
3 TRCN0000372101 GGTCAGCTGGAGCTATGATAA pLKO_005 2500 CDS 100% 13.200 9.240 N PAMR1 n/a
4 TRCN0000056042 CCAGGTTGTACCATCTTTGAA pLKO.1 683 CDS 100% 5.625 3.938 N PAMR1 n/a
5 TRCN0000056041 GAGCCTACAGATTTCTGCTAT pLKO.1 2053 CDS 100% 4.950 3.465 N PAMR1 n/a
6 TRCN0000056039 CCAACTAAGATTTGTCATGTT pLKO.1 922 CDS 100% 4.950 2.970 N PAMR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02880 pDONR223 100% 92.2% 92.2% None 0_1ins120;700_701ins51 n/a
2 ccsbBroad304_02880 pLX_304 0% 92.2% 92.2% V5 0_1ins120;700_701ins51 n/a
3 TRCN0000477550 GGCTCTTTACCACCTTGGTCTCTG pLX_317 17.5% 92.2% 92.2% V5 0_1ins120;700_701ins51 n/a
Download CSV