Transcript: Human XM_011524660.1

PREDICTED: Homo sapiens endonuclease V (ENDOV), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENDOV (284131)
Length:
1284
CDS:
29..1042

Additional Resources:

NCBI RefSeq record:
XM_011524660.1
NBCI Gene record:
ENDOV (284131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051059 GTTGACGTGTCCTTCGTGAAA pLKO.1 179 CDS 100% 4.950 6.930 N ENDOV n/a
2 TRCN0000051061 GAAACGCTGTCACTGTGGAAA pLKO.1 62 CDS 100% 4.950 3.465 N ENDOV n/a
3 TRCN0000420704 GGTCCTTCTTGTGGATGGAAA pLKO_005 256 CDS 100% 4.950 3.465 N ENDOV n/a
4 TRCN0000436957 AGGAGACTCATTCCCTCTGCT pLKO_005 430 CDS 100% 2.640 1.848 N ENDOV n/a
5 TRCN0000051060 CCTGCCACCTTGGCGTCCTTA pLKO.1 309 CDS 100% 0.000 0.000 N ENDOV n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05375 pDONR223 100% 74.1% 71.6% None (many diffs) n/a
2 ccsbBroad304_05375 pLX_304 0% 74.1% 71.6% V5 (many diffs) n/a
3 TRCN0000471000 AGTCGCACCAAACGCTTGGGTGCG pLX_317 38.3% 74.1% 71.6% V5 (many diffs) n/a
Download CSV