Transcript: Human XM_011523724.1

PREDICTED: Homo sapiens sphingolipid transporter 3 (putative) (SPNS3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPNS3 (201305)
Length:
1778
CDS:
29..1468

Additional Resources:

NCBI RefSeq record:
XM_011523724.1
NBCI Gene record:
SPNS3 (201305)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157852 CTGGTTTGCTTCAGACTGTCT pLKO.1 276 CDS 100% 2.640 3.696 N SPNS3 n/a
2 TRCN0000158239 CAGTGACAACCATGCTGGTTT pLKO.1 262 CDS 100% 4.950 3.465 N SPNS3 n/a
3 TRCN0000152513 GAGGAGGTACAAGAAAGTCAT pLKO.1 1018 CDS 100% 4.950 3.465 N SPNS3 n/a
4 TRCN0000157107 GACAACCATGCTGGTTTGCTT pLKO.1 266 CDS 100% 3.000 2.100 N SPNS3 n/a
5 TRCN0000151856 CCTGAATTACATGAACTGGTT pLKO.1 196 CDS 100% 2.640 1.848 N SPNS3 n/a
6 TRCN0000156296 CTGCTGGATATACAGGAGGTT pLKO.1 233 CDS 100% 2.640 1.848 N SPNS3 n/a
7 TRCN0000153838 CTGGCTGTCTTCTACATCTTT pLKO.1 548 CDS 100% 5.625 3.375 N SPNS3 n/a
8 TRCN0000157013 GCTGGCTGTCTTCTACATCTT pLKO.1 547 CDS 100% 4.950 2.970 N SPNS3 n/a
9 TRCN0000158382 CGAGGAGGTACAAGAAAGTCA pLKO.1 1017 CDS 100% 3.000 1.800 N SPNS3 n/a
10 TRCN0000157784 CAGCAATGATGTGGACAGCAA pLKO.1 1390 CDS 100% 2.640 1.584 N SPNS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13390 pDONR223 100% 68.5% 67.2% None (many diffs) n/a
2 ccsbBroad304_13390 pLX_304 0% 68.5% 67.2% V5 (many diffs) n/a
3 TRCN0000470856 TGTATGATCACCTAGATTGAGATT pLX_317 19.4% 68.5% 67.2% V5 (many diffs) n/a
Download CSV