Transcript: Human XM_005255403.2

PREDICTED: Homo sapiens zinc finger and SCAN domain containing 32 (ZSCAN32), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZSCAN32 (54925)
Length:
2908
CDS:
309..2141

Additional Resources:

NCBI RefSeq record:
XM_005255403.2
NBCI Gene record:
ZSCAN32 (54925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419533 ACACTTTCTGGGCTAACATAG pLKO_005 2451 3UTR 100% 10.800 15.120 N ZSCAN32 n/a
2 TRCN0000435096 CGTTATGAGTGTGTCGGTAAA pLKO_005 2134 CDS 100% 10.800 15.120 N ZSCAN32 n/a
3 TRCN0000015687 GAGTTCAAGAACGAGATTAAA pLKO.1 1287 CDS 100% 15.000 12.000 N ZSCAN32 n/a
4 TRCN0000015683 CCTACAGTTGAGTTACCGCAA pLKO.1 983 CDS 100% 2.160 1.728 N ZSCAN32 n/a
5 TRCN0000417648 GAAAGTCCAGAGGAGTTTATT pLKO_005 1366 CDS 100% 15.000 10.500 N ZSCAN32 n/a
6 TRCN0000419632 CAAGAAGGCAATGTAGAAATT pLKO_005 1429 CDS 100% 13.200 9.240 N ZSCAN32 n/a
7 TRCN0000417128 GAAAGCTGTAGGATCCATAAA pLKO_005 2366 3UTR 100% 13.200 9.240 N ZSCAN32 n/a
8 TRCN0000429183 TGATTCAGAGGAAGTAGAAAT pLKO_005 1328 CDS 100% 13.200 9.240 N ZSCAN32 n/a
9 TRCN0000427480 AGTATCTCAATGTCCTGAATG pLKO_005 1604 CDS 100% 10.800 7.560 N ZSCAN32 n/a
10 TRCN0000015684 CTTATCTTGTTCGGCATCAAA pLKO.1 1648 CDS 100% 5.625 3.938 N ZSCAN32 n/a
11 TRCN0000015686 CTGTGGAAAGAGATTCAACAA pLKO.1 1874 CDS 100% 4.950 3.465 N ZSCAN32 n/a
12 TRCN0000015685 GCTATTCTTAGTAGTTCTCAA pLKO.1 843 CDS 100% 4.950 3.465 N ZSCAN32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12112 pDONR223 100% 24.2% 23.8% None (many diffs) n/a
2 ccsbBroad304_12112 pLX_304 0% 24.2% 23.8% V5 (many diffs) n/a
3 TRCN0000466479 TATGCTCGCCCTCGCGTCCTGGCA pLX_317 56.9% 24.2% 23.8% V5 (many diffs) n/a
Download CSV