Transcript: Human XR_941487.1

PREDICTED: Homo sapiens WD repeat and FYVE domain containing 2 (WDFY2), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDFY2 (115825)
Length:
2163
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_941487.1
NBCI Gene record:
WDFY2 (115825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_941487.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195876 CAGGACAGTTCGTGTTTGGTT pLKO.1 366 3UTR 100% 3.000 4.200 N Wdfy2 n/a
2 TRCN0000423311 TGCACAGCACACGCGACAATT pLKO_005 981 3UTR 100% 13.200 10.560 N WDFY2 n/a
3 TRCN0000156031 CCATAGGTCTAGACAATGGTA pLKO.1 482 3UTR 100% 3.000 2.400 N WDFY2 n/a
4 TRCN0000216850 GGTCTAGACAATGGTACAATC pLKO.1 487 3UTR 100% 10.800 7.560 N Wdfy2 n/a
5 TRCN0000242080 GGTCTAGACAATGGTACAATC pLKO_005 487 3UTR 100% 10.800 7.560 N Wdfy2 n/a
6 TRCN0000156182 CAAGCAAATGTGGGACAGTAA pLKO.1 2141 3UTR 100% 4.950 3.465 N WDFY2 n/a
7 TRCN0000156445 CAGAGTGACGATGATCCTGTT pLKO.1 576 3UTR 100% 4.050 2.835 N WDFY2 n/a
8 TRCN0000156358 CTCTGTCATCATGTGGGACAT pLKO.1 894 3UTR 100% 4.050 2.835 N WDFY2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_941487.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04688 pDONR223 100% 48.5% None (many diffs) n/a
2 ccsbBroad304_04688 pLX_304 0% 48.5% V5 (many diffs) n/a
3 TRCN0000474486 ACCACCACCCACTCCAGAACCCGG pLX_317 30.7% 48.5% V5 (many diffs) n/a
Download CSV