Transcript: Human XM_011512235.1

PREDICTED: Homo sapiens FERM, ARH/RhoGEF and pleckstrin domain protein 2 (FARP2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FARP2 (9855)
Length:
4288
CDS:
534..3572

Additional Resources:

NCBI RefSeq record:
XM_011512235.1
NBCI Gene record:
FARP2 (9855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047262 CGTCTTTACCAACTTCTGTTT pLKO.1 3260 CDS 100% 4.950 3.960 N FARP2 n/a
2 TRCN0000047259 CCTCAAGGATTTAGAAGTTAT pLKO.1 2036 CDS 100% 13.200 9.240 N FARP2 n/a
3 TRCN0000047261 GCAGTCGGAAATAGGAGATTA pLKO.1 890 CDS 100% 13.200 9.240 N FARP2 n/a
4 TRCN0000047258 CCTGGTAGAATGTGACTACTT pLKO.1 620 CDS 100% 4.950 3.465 N FARP2 n/a
5 TRCN0000047260 CCAGTTCAAATCCCACGTCTA pLKO.1 3398 CDS 100% 4.050 2.835 N FARP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11425 pDONR223 100% 55.2% 54% None (many diffs) n/a
2 ccsbBroad304_11425 pLX_304 0% 55.2% 54% V5 (many diffs) n/a
3 TRCN0000469129 GCGCATATCCTACTGTCGTAACAA pLX_317 21.1% 55.2% 54% V5 (many diffs) n/a
Download CSV