Transcript: Human XM_011510939.1

PREDICTED: Homo sapiens spermatogenesis associated serine rich 2 like (SPATS2L), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATS2L (26010)
Length:
2391
CDS:
216..1892

Additional Resources:

NCBI RefSeq record:
XM_011510939.1
NBCI Gene record:
SPATS2L (26010)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510939.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053101 CGGAGATTTAATCCACAGTAT pLKO.1 1518 CDS 100% 4.950 6.930 N SPATS2L n/a
2 TRCN0000290893 CGGAGATTTAATCCACAGTAT pLKO_005 1518 CDS 100% 4.950 6.930 N SPATS2L n/a
3 TRCN0000053100 GCACCGTTTCTCTAACTAGAT pLKO.1 907 CDS 100% 4.950 6.930 N SPATS2L n/a
4 TRCN0000290823 GCACCGTTTCTCTAACTAGAT pLKO_005 907 CDS 100% 4.950 6.930 N SPATS2L n/a
5 TRCN0000053098 CGGAGAAATTACACATCCAAA pLKO.1 1268 CDS 100% 4.950 3.960 N SPATS2L n/a
6 TRCN0000290894 CGGAGAAATTACACATCCAAA pLKO_005 1268 CDS 100% 4.950 3.960 N SPATS2L n/a
7 TRCN0000053099 CCACAGATTCTGCTAACGAAA pLKO.1 565 CDS 100% 4.950 3.465 N SPATS2L n/a
8 TRCN0000290892 CCACAGATTCTGCTAACGAAA pLKO_005 565 CDS 100% 4.950 3.465 N SPATS2L n/a
9 TRCN0000053102 GCTCGTCAGAAGAAAGCAGAA pLKO.1 1077 CDS 100% 4.050 2.835 N SPATS2L n/a
10 TRCN0000290891 GCTCGTCAGAAGAAAGCAGAA pLKO_005 1077 CDS 100% 4.050 2.835 N SPATS2L n/a
11 TRCN0000282603 GTTCCGTGAAGAAGATCAAAG pLKO_005 958 CDS 100% 10.800 6.480 N Spats2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510939.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11798 pDONR223 100% 87.4% 87.4% None 189_191delAAA;444_650del n/a
2 ccsbBroad304_11798 pLX_304 0% 87.4% 87.4% V5 189_191delAAA;444_650del n/a
3 TRCN0000471007 CAGACCAACGATTAGCTAACTTTT pLX_317 25% 87.4% 87.4% V5 189_191delAAA;444_650del n/a
Download CSV