Transcript: Human XM_011528394.1

PREDICTED: Homo sapiens RAN binding protein 3 (RANBP3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RANBP3 (8498)
Length:
2854
CDS:
523..1383

Additional Resources:

NCBI RefSeq record:
XM_011528394.1
NBCI Gene record:
RANBP3 (8498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073004 CCAGTATATCAGTTCCAGTTT pLKO.1 579 CDS 100% 4.950 6.930 N RANBP3 n/a
2 TRCN0000073005 CGCGGAAGTGTTTGTTGGAAA pLKO.1 821 CDS 100% 4.950 6.930 N RANBP3 n/a
3 TRCN0000307781 CGCGGAAGTGTTTGTTGGAAA pLKO_005 821 CDS 100% 4.950 6.930 N RANBP3 n/a
4 TRCN0000073006 GCCCGTCTTTGTGTTTCAGAA pLKO.1 49 5UTR 100% 4.950 6.930 N RANBP3 n/a
5 TRCN0000291871 GCCCGTCTTTGTGTTTCAGAA pLKO_005 49 5UTR 100% 4.950 6.930 N RANBP3 n/a
6 TRCN0000303295 GACACGAGACCTCATCATATT pLKO_005 1571 3UTR 100% 13.200 10.560 N RANBP3 n/a
7 TRCN0000303294 GACAGAGTTAAGCTGATAAAT pLKO_005 481 5UTR 100% 15.000 10.500 N RANBP3 n/a
8 TRCN0000073007 CAGTATATCAGTTCCAGTTTA pLKO.1 580 CDS 100% 13.200 9.240 N RANBP3 n/a
9 TRCN0000370148 TGAATTGAAATGGCACATTAA pLKO_005 1633 3UTR 100% 13.200 9.240 N RANBP3 n/a
10 TRCN0000370149 ACGAAGCCGACATGGAGAATG pLKO_005 512 5UTR 100% 10.800 7.560 N RANBP3 n/a
11 TRCN0000073003 CCTCACCAAATCTTGGTGGAA pLKO.1 2385 3UTR 100% 0.264 0.185 N RANBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13995 pDONR223 100% 34.6% 26.3% None (many diffs) n/a
2 ccsbBroad304_13995 pLX_304 0% 34.6% 26.3% V5 (many diffs) n/a
3 TRCN0000480060 TACAGAACTGGTGAATCAAGTAAC pLX_317 36% 34.6% 26.3% V5 (many diffs) n/a
Download CSV