Transcript: Mouse XM_006499022.2

PREDICTED: Mus musculus ribophorin II (Rpn2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rpn2 (20014)
Length:
2591
CDS:
313..2256

Additional Resources:

NCBI RefSeq record:
XM_006499022.2
NBCI Gene record:
Rpn2 (20014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011908 CCTGGCAAGATGCTGTGAATA pLKO.1 2484 3UTR 100% 13.200 9.240 N Rpn2 n/a
2 TRCN0000278088 CCTGGCAAGATGCTGTGAATA pLKO_005 2484 3UTR 100% 13.200 9.240 N Rpn2 n/a
3 TRCN0000011909 GCCAGATAACAAGAATGTATA pLKO.1 1668 CDS 100% 13.200 9.240 N Rpn2 n/a
4 TRCN0000277981 GCCAGATAACAAGAATGTATA pLKO_005 1668 CDS 100% 13.200 9.240 N Rpn2 n/a
5 TRCN0000011912 GCTGGGCCTCATGTATATCTA pLKO.1 2070 CDS 100% 5.625 3.938 N Rpn2 n/a
6 TRCN0000278157 GCTGGGCCTCATGTATATCTA pLKO_005 2070 CDS 100% 5.625 3.938 N Rpn2 n/a
7 TRCN0000011911 GCTGTGAGATATCTGTTTCAA pLKO.1 608 CDS 100% 5.625 3.938 N Rpn2 n/a
8 TRCN0000278158 GCTGTGAGATATCTGTTTCAA pLKO_005 608 CDS 100% 5.625 3.938 N Rpn2 n/a
9 TRCN0000011910 CCACTGAAGTTGGCATCACAA pLKO.1 1421 CDS 100% 4.950 3.465 N Rpn2 n/a
10 TRCN0000166805 CCACTGAAGTTGGCATCACAA pLKO.1 1421 CDS 100% 4.950 3.465 N RPN2 n/a
11 TRCN0000278089 CCACTGAAGTTGGCATCACAA pLKO_005 1421 CDS 100% 4.950 3.465 N Rpn2 n/a
12 TRCN0000166435 CTACTGGACTCAGCTCAACAT pLKO.1 2088 CDS 100% 4.950 3.465 N RPN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06889 pDONR223 100% 86.1% 89.7% None (many diffs) n/a
2 ccsbBroad304_06889 pLX_304 0% 86.1% 89.7% V5 (many diffs) n/a
3 TRCN0000468836 CCGGATGGGTGTAGACAACCATGT pLX_317 20.2% 86.1% 89.7% V5 (many diffs) n/a
Download CSV