Transcript: Mouse XM_006540257.2

PREDICTED: Mus musculus actinin alpha 4 (Actn4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Actn4 (60595)
Length:
3955
CDS:
170..2974

Additional Resources:

NCBI RefSeq record:
XM_006540257.2
NBCI Gene record:
Actn4 (60595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090216 CGCTGAGAGCAATCACATCAA pLKO.1 1963 CDS 100% 4.950 3.960 N Actn4 n/a
2 TRCN0000309801 CGCTGAGAGCAATCACATCAA pLKO_005 1963 CDS 100% 4.950 3.960 N Actn4 n/a
3 TRCN0000090214 GCACAAGATCAACAATGTAAA pLKO.1 490 CDS 100% 13.200 9.240 N Actn4 n/a
4 TRCN0000309727 GCACAAGATCAACAATGTAAA pLKO_005 490 CDS 100% 13.200 9.240 N Actn4 n/a
5 TRCN0000090213 CCTCTCTTTCTCAGTCTTGTA pLKO.1 3114 3UTR 100% 4.950 3.465 N Actn4 n/a
6 TRCN0000309728 CCTCTCTTTCTCAGTCTTGTA pLKO_005 3114 3UTR 100% 4.950 3.465 N Actn4 n/a
7 TRCN0000090215 GCATTTGAAGTGGCTGAGAAA pLKO.1 851 CDS 100% 4.950 3.465 N Actn4 n/a
8 TRCN0000309730 GCATTTGAAGTGGCTGAGAAA pLKO_005 851 CDS 100% 4.950 3.465 N Actn4 n/a
9 TRCN0000090217 CCTTCATTGACTTCATGTCAA pLKO.1 2727 CDS 100% 0.495 0.297 N Actn4 n/a
10 TRCN0000309799 CCTTCATTGACTTCATGTCAA pLKO_005 2727 CDS 100% 0.495 0.297 N Actn4 n/a
11 TRCN0000055787 CAGGACATGTTCATCGTCCAT pLKO.1 1826 CDS 100% 2.640 1.584 N ACTN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00016 pDONR223 100% 88.7% 96.1% None (many diffs) n/a
2 ccsbBroad304_00016 pLX_304 0% 88.7% 96.1% V5 (many diffs) n/a
3 TRCN0000478445 AACAATATTTTCATGGGGTGCCTC pLX_317 12.7% 88.7% 96.1% V5 (many diffs) n/a
Download CSV