Transcript: Mouse XM_006513719.2

PREDICTED: Mus musculus 1-acylglycerol-3-phosphate O-acyltransferase 3 (Agpat3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Agpat3 (28169)
Length:
5970
CDS:
327..1457

Additional Resources:

NCBI RefSeq record:
XM_006513719.2
NBCI Gene record:
Agpat3 (28169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513719.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126755 CTAGAGATCGTATTCTGCAAA pLKO.1 741 CDS 100% 4.950 6.930 N Agpat3 n/a
2 TRCN0000317960 CTAGAGATCGTATTCTGCAAA pLKO_005 741 CDS 100% 4.950 6.930 N Agpat3 n/a
3 TRCN0000126757 GATCGTATTCTGCAAACGGAA pLKO.1 746 CDS 100% 2.640 3.696 N Agpat3 n/a
4 TRCN0000126758 GTACAAGCAGAAGGGTGTATT pLKO.1 1187 CDS 100% 13.200 10.560 N Agpat3 n/a
5 TRCN0000317961 GTACAAGCAGAAGGGTGTATT pLKO_005 1187 CDS 100% 13.200 10.560 N Agpat3 n/a
6 TRCN0000126754 GCTGTGATTGAACACCCATAA pLKO.1 1463 3UTR 100% 10.800 7.560 N Agpat3 n/a
7 TRCN0000318030 GCTGTGATTGAACACCCATAA pLKO_005 1463 3UTR 100% 10.800 7.560 N Agpat3 n/a
8 TRCN0000126756 GCTATGGCAACCAAGAGCTTA pLKO.1 1423 CDS 100% 4.950 3.465 N Agpat3 n/a
9 TRCN0000318029 GCTATGGCAACCAAGAGCTTA pLKO_005 1423 CDS 100% 4.950 3.465 N Agpat3 n/a
10 TRCN0000035135 CCTCAACCACAACTTCGAGAT pLKO.1 605 CDS 100% 4.050 2.835 N AGPAT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513719.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08654 pDONR223 100% 86.2% 92.2% None (many diffs) n/a
2 ccsbBroad304_08654 pLX_304 0% 86.2% 92.2% V5 (many diffs) n/a
3 TRCN0000467671 GGAGATGCTCACATGTAGACGTCT pLX_317 36.1% 86.2% 92.2% V5 (many diffs) n/a
4 ccsbBroadEn_03749 pDONR223 100% 86.2% 92.2% None (many diffs) n/a
5 ccsbBroad304_03749 pLX_304 0% 86.2% 92.2% V5 (many diffs) n/a
6 TRCN0000474403 CCAAGTCGCCTCGGGGTTTTTTTC pLX_317 30.5% 86.2% 92.2% V5 (many diffs) n/a
Download CSV