Transcript: Mouse NM_010544.3

Mus musculus Indian hedgehog (Ihh), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ihh (16147)
Length:
2476
CDS:
459..1694

Additional Resources:

NCBI RefSeq record:
NM_010544.3
NBCI Gene record:
Ihh (16147)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031068 CCTCGCAAGCTCGTGCCTCTT pLKO.1 579 CDS 100% 0.000 0.000 N Ihh n/a
2 TRCN0000031065 GCTCTGTCAAGTCTGAGCATT pLKO.1 1021 CDS 100% 4.950 3.960 N Ihh n/a
3 TRCN0000031064 CAGGCCAATATGTGCTGGTAT pLKO.1 1357 CDS 100% 4.950 3.465 N Ihh n/a
4 TRCN0000031066 CCTGCGACTGTTTCCCAGTTT pLKO.1 1547 CDS 100% 4.950 3.465 N Ihh n/a
5 TRCN0000031067 CTGGGTGTATTACGAGTCCAA pLKO.1 986 CDS 100% 2.640 1.848 N Ihh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10918 pDONR223 100% 62.9% 67.6% None (many diffs) n/a
2 ccsbBroad304_10918 pLX_304 0% 62.9% 67.6% V5 (many diffs) n/a
3 TRCN0000471091 TGGACAAATGACTGTCGTACCGTT pLX_317 51% 62.9% 67.6% V5 (many diffs) n/a
Download CSV