Transcript: Human NM_001318187.1

Homo sapiens heterogeneous nuclear ribonucleoprotein K (HNRNPK), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
HNRNPK (3190)
Length:
2890
CDS:
227..1549

Additional Resources:

NCBI RefSeq record:
NM_001318187.1
NBCI Gene record:
HNRNPK (3190)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296044 CGTTATTGTTGGTGGTTTAAA pLKO_005 1840 3UTR 100% 15.000 21.000 N HNRNPK n/a
2 TRCN0000062454 TGCCAGTGTTTCAGTCCCAGA pLKO.1 445 CDS 100% 2.160 3.024 N HNRNPK n/a
3 TRCN0000062456 TGATGTTTGATGACCGTCGCG pLKO.1 876 CDS 100% 0.540 0.756 N HNRNPK n/a
4 TRCN0000310326 TGATGTTTGATGACCGTCGCG pLKO_005 876 CDS 100% 0.540 0.756 N HNRNPK n/a
5 TRCN0000295993 AGATTTGGCTGGATCTATTAT pLKO_005 1342 CDS 100% 15.000 10.500 N HNRNPK n/a
6 TRCN0000295992 TGATCTTGGTGGACCTATTAT pLKO_005 1297 CDS 100% 15.000 10.500 N HNRNPK n/a
7 TRCN0000295994 CAGATGTTGAAGGATTCTAAT pLKO_005 1530 CDS 100% 13.200 9.240 N HNRNPK n/a
8 TRCN0000062453 CTCTGTTGTATGTTGGATTAT pLKO.1 2625 3UTR 100% 13.200 9.240 N HNRNPK n/a
9 TRCN0000096826 CCAAAGATTTGGCTGGATCTA pLKO.1 1338 CDS 100% 4.950 3.465 N Hnrnpk n/a
10 TRCN0000062457 ATGATGTTTGATGACCGTCGC pLKO.1 875 CDS 100% 1.200 0.840 N HNRNPK n/a
11 TRCN0000062455 GCCAGTGTTTCAGTCCCAGAC pLKO.1 446 CDS 100% 0.750 0.525 N HNRNPK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00768 pDONR223 100% 94.8% 94.8% None 330_331ins72 n/a
2 ccsbBroad304_00768 pLX_304 0% 94.8% 94.8% V5 330_331ins72 n/a
3 TRCN0000468412 CCCCATTGTATATAGATTGTGAAT pLX_317 32.5% 94.8% 94.8% V5 330_331ins72 n/a
4 ccsbBroadEn_06391 pDONR223 100% 93.9% 93.7% None (many diffs) n/a
5 ccsbBroad304_06391 pLX_304 0% 93.9% 93.7% V5 (many diffs) n/a
6 TRCN0000468999 AGATGCTGATCGCCCCCACGGCCG pLX_317 31.7% 93.9% 93.7% V5 (many diffs) n/a
Download CSV