Transcript: Human NM_001322221.1

Homo sapiens DEAH-box helicase 8 (DHX8), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
DHX8 (1659)
Length:
4304
CDS:
174..3830

Additional Resources:

NCBI RefSeq record:
NM_001322221.1
NBCI Gene record:
DHX8 (1659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433974 ACCATCCCAGGTCGAACATAT pLKO_005 2373 CDS 100% 13.200 10.560 N DHX8 n/a
2 TRCN0000430329 AGCTCGTGGTGACGCCTATTT pLKO_005 2785 CDS 100% 13.200 10.560 N DHX8 n/a
3 TRCN0000000025 GACCCAACTAAGCTAAGCAAA pLKO.1 3720 CDS 100% 4.950 3.960 N DHX8 n/a
4 TRCN0000421309 AGAGACTGGAGAAGATCTAAA pLKO_005 1187 CDS 100% 13.200 9.240 N DHX8 n/a
5 TRCN0000010513 TGGCTTGACCTCGTGGAAATA pLKO.1 4260 3UTR 100% 13.200 9.240 N DHX8 n/a
6 TRCN0000430619 TCTGGATAGATGGCGGGATAA pLKO_005 902 CDS 100% 10.800 7.560 N DHX8 n/a
7 TRCN0000000026 AGACAGAGATAGGGAACGAAA pLKO.1 725 CDS 100% 4.950 3.465 N DHX8 n/a
8 TRCN0000000027 CCACCAATATCGCAGAGACAT pLKO.1 2680 CDS 100% 4.950 3.465 N DHX8 n/a
9 TRCN0000000028 CCTGCCCATCTACAAACTGAA pLKO.1 1859 CDS 100% 4.950 3.465 N DHX8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10427 pDONR223 100% 99.2% 99.2% None (many diffs) n/a
2 ccsbBroad304_10427 pLX_304 0% 99.2% 99.2% V5 (many diffs) n/a
3 TRCN0000480235 AGAATCGTTCCCCGGGAAGTCTCT pLX_317 12.4% 99.2% 99.2% V5 (many diffs) n/a
Download CSV