Transcript: Human XM_017014300.1

PREDICTED: Homo sapiens DAB2 interacting protein (DAB2IP), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DAB2IP (153090)
Length:
6477
CDS:
248..3445

Additional Resources:

NCBI RefSeq record:
XM_017014300.1
NBCI Gene record:
DAB2IP (153090)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014300.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412261 ACGATCTTTCCGGTCTGATAG pLKO_005 1941 CDS 100% 10.800 15.120 N DAB2IP n/a
2 TRCN0000414427 AGGGATAGGCTAAGGAGTAAG pLKO_005 2951 CDS 100% 10.800 15.120 N DAB2IP n/a
3 TRCN0000001457 GTAATGTAACTATCTCACCTA pLKO.1 5572 3UTR 100% 2.640 3.696 N DAB2IP n/a
4 TRCN0000421423 GCTGGAGCAGAGCATAGTATC pLKO_005 1765 CDS 100% 10.800 8.640 N DAB2IP n/a
5 TRCN0000001458 GACTCCAAACAGAAGATCATT pLKO.1 3248 CDS 100% 5.625 4.500 N DAB2IP n/a
6 TRCN0000423830 ATGTCGCCCTCACTCTTCAAC pLKO_005 1466 CDS 100% 4.950 3.960 N DAB2IP n/a
7 TRCN0000424247 TTCGAGGTGACGACGTCATCA pLKO_005 386 CDS 100% 4.950 3.960 N DAB2IP n/a
8 TRCN0000421763 GTGCGCACTGCATGGGAAATA pLKO_005 4547 3UTR 100% 13.200 9.240 N DAB2IP n/a
9 TRCN0000422206 GCAAGCTCAAGACGGACAATG pLKO_005 615 CDS 100% 10.800 7.560 N DAB2IP n/a
10 TRCN0000413139 TGCCCATGGAGATGTACAAAG pLKO_005 894 CDS 100% 10.800 7.560 N DAB2IP n/a
11 TRCN0000415097 ACATCAGTGAGCGGCTCATCA pLKO_005 1407 CDS 100% 4.950 3.465 N DAB2IP n/a
12 TRCN0000001459 GAGTTCATCAAAGCGCTGTAT pLKO.1 1193 CDS 100% 4.950 3.465 N DAB2IP n/a
13 TRCN0000419461 TGCAGGACAAGCTGCGAATCT pLKO_005 3009 CDS 100% 4.950 3.465 N DAB2IP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014300.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13291 pDONR223 100% 97.2% 97.1% None 3101delG;3105_3106delCAinsT;3111_3195del n/a
2 ccsbBroad304_13291 pLX_304 0% 97.2% 97.1% V5 3101delG;3105_3106delCAinsT;3111_3195del n/a
3 TRCN0000476703 GCTCTAGTGTACCAACGTGGAGAT pLX_317 12.3% 97.2% 97.1% V5 3101delG;3105_3106delCAinsT;3111_3195del n/a
Download CSV