Transcript: Human XM_011519405.2

PREDICTED: Homo sapiens BEN domain containing 7 (BEND7), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BEND7 (222389)
Length:
1889
CDS:
50..1180

Additional Resources:

NCBI RefSeq record:
XM_011519405.2
NBCI Gene record:
BEND7 (222389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243931 GATCGCGGACAGTGATGAAAG pLKO_005 1120 CDS 100% 10.800 15.120 N BEND7 n/a
2 TRCN0000243932 ACCTCCAATTTCCCTTATATG pLKO_005 526 CDS 100% 13.200 9.240 N BEND7 n/a
3 TRCN0000243933 CAGATTCTACAGGATCAAATT pLKO_005 1061 CDS 100% 13.200 9.240 N BEND7 n/a
4 TRCN0000243930 TTGACGTGTTTATGCCTAAAT pLKO_005 795 CDS 100% 13.200 9.240 N BEND7 n/a
5 TRCN0000172673 GCTCAGGAAGCCTTCTGTTTA pLKO.1 849 CDS 100% 13.200 7.920 N BEND7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13437 pDONR223 100% 96.7% 96.5% None (many diffs) n/a
2 ccsbBroad304_13437 pLX_304 0% 96.7% 96.5% V5 (many diffs) n/a
3 TRCN0000478485 GACCTCCTCGGGGGACTGGACCCA pLX_317 23.8% 96.7% 96.5% V5 (many diffs) n/a
Download CSV