Transcript: Human XM_011538992.2

PREDICTED: Homo sapiens solute carrier family 16 member 7 (SLC16A7), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC16A7 (9194)
Length:
12734
CDS:
1058..2572

Additional Resources:

NCBI RefSeq record:
XM_011538992.2
NBCI Gene record:
SLC16A7 (9194)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294347 CAACCCGCCTTAACCATAATT pLKO_005 1520 CDS 100% 15.000 21.000 N SLC16A7 n/a
2 TRCN0000294346 GAATCCATGCTATAGGTTTAT pLKO_005 2782 3UTR 100% 13.200 18.480 N SLC16A7 n/a
3 TRCN0000038504 GCAGGTAAATTGGTGGATTTA pLKO.1 2312 CDS 100% 1.320 1.848 N SLC16A7 n/a
4 TRCN0000286932 GCAGGTAAATTGGTGGATTTA pLKO_005 2312 CDS 100% 1.320 1.848 N SLC16A7 n/a
5 TRCN0000038506 GCTCCTTTCAATCAGTACCTT pLKO.1 1619 CDS 100% 3.000 2.400 N SLC16A7 n/a
6 TRCN0000038508 CCTTGAGCAAATCTAAACATT pLKO.1 2484 CDS 100% 5.625 3.938 N SLC16A7 n/a
7 TRCN0000286881 CCTTGAGCAAATCTAAACATT pLKO_005 2484 CDS 100% 5.625 3.938 N SLC16A7 n/a
8 TRCN0000038507 GCCTGGTATTATATGCTGTAT pLKO.1 2151 CDS 100% 4.950 3.465 N SLC16A7 n/a
9 TRCN0000038505 CGAAGAAATCAACTTGGGAAA pLKO.1 1809 CDS 100% 4.050 2.835 N SLC16A7 n/a
10 TRCN0000286933 CGAAGAAATCAACTTGGGAAA pLKO_005 1809 CDS 100% 4.050 2.835 N SLC16A7 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6829 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6829 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07373 pDONR223 100% 94.7% 94.6% None 10A>G;216_293del n/a
2 ccsbBroad304_07373 pLX_304 0% 94.7% 94.6% V5 10A>G;216_293del n/a
Download CSV