Transcript: Human XR_001737397.1

PREDICTED: Homo sapiens complement C8 beta chain (C8B), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C8B (732)
Length:
1829
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737397.1
NBCI Gene record:
C8B (732)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426624 GATCGAGGCAAACACTATATT pLKO_005 917 3UTR 100% 15.000 21.000 N C8B n/a
2 TRCN0000430320 GTTCTTGATCACAGGTATTAT pLKO_005 668 3UTR 100% 15.000 21.000 N C8B n/a
3 TRCN0000057100 CCAAACGATTCTCTCATACTA pLKO.1 945 3UTR 100% 5.625 7.875 N C8B n/a
4 TRCN0000057099 CCATTGATTGTGAGCTGTCTA pLKO.1 285 3UTR 100% 4.950 3.960 N C8B n/a
5 TRCN0000057098 GCTCTGGAAGACGTAAGACAA pLKO.1 1529 3UTR 100% 4.950 3.960 N C8B n/a
6 TRCN0000057102 CAGAGGTATTCTGAATGAAAT pLKO.1 1068 3UTR 100% 13.200 9.240 N C8B n/a
7 TRCN0000057101 GAACGCAATGTCACAGAGAAA pLKO.1 821 3UTR 100% 4.950 3.465 N C8B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05915 pDONR223 100% 73.9% None (many diffs) n/a
2 ccsbBroad304_05915 pLX_304 0% 73.9% V5 (many diffs) n/a
3 TRCN0000481247 GATCTATTCCAGGGTGACACGGTT pLX_317 24.6% 73.9% V5 (many diffs) n/a
Download CSV