Transcript: Human XM_017023741.1

PREDICTED: Homo sapiens stannin (SNN), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNN (8303)
Length:
3316
CDS:
84..488

Additional Resources:

NCBI RefSeq record:
XM_017023741.1
NBCI Gene record:
SNN (8303)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023741.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337076 GGAGGGTCATAGGCTTGTAAA pLKO_005 939 3UTR 100% 13.200 18.480 N SNN n/a
2 TRCN0000337074 GTAATGCGTGAACTAACAAAC pLKO_005 792 3UTR 100% 10.800 15.120 N SNN n/a
3 TRCN0000152843 GCTACTACTGTAATGCGTGAA pLKO.1 783 3UTR 100% 4.050 5.670 N SNN n/a
4 TRCN0000337008 CCTTCCTGCTGGTGCAGTATT pLKO_005 397 CDS 100% 13.200 9.240 N SNN n/a
5 TRCN0000337007 GGTATTCTGGCTGTACTAATG pLKO_005 898 3UTR 100% 10.800 7.560 N SNN n/a
6 TRCN0000151267 CCAACTGTTGCATTCAAGTTT pLKO.1 2996 3UTR 100% 5.625 3.938 N SNN n/a
7 TRCN0000153454 CCACACTCAAATGGCTAAGTA pLKO.1 2943 3UTR 100% 5.625 3.938 N SNN n/a
8 TRCN0000154766 GCAACAGCTAGGATCTGCATT pLKO.1 2574 3UTR 100% 4.950 3.465 N SNN n/a
9 TRCN0000152842 GCTGTTCGTTTAAGCAGCATA pLKO.1 2099 3UTR 100% 4.950 3.465 N SNN n/a
10 TRCN0000337010 TGGTCACAGTCATCGTCATCC pLKO_005 256 CDS 100% 4.050 2.835 N SNN n/a
11 TRCN0000151092 GTGAACTAACAAACCTGTGAA pLKO.1 799 3UTR 100% 4.950 2.970 N SNN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023741.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01886 pDONR223 100% 65.6% 65.6% None 1_138del n/a
2 ccsbBroad304_01886 pLX_304 0% 65.6% 65.6% V5 1_138del n/a
3 TRCN0000467293 GAACAAGGCTCTTGCCCGTGGTAT pLX_317 100% 65.6% 65.6% V5 1_138del n/a
Download CSV