Transcript: Human XM_017005783.1

PREDICTED: Homo sapiens contactin 4 (CNTN4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNTN4 (152330)
Length:
7109
CDS:
1169..4249

Additional Resources:

NCBI RefSeq record:
XM_017005783.1
NBCI Gene record:
CNTN4 (152330)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371864 TTAGCTGTCAAGGCATATAAT pLKO_005 3791 CDS 100% 15.000 21.000 N CNTN4 n/a
2 TRCN0000073441 GCTGGGAGTTATACCTGTATA pLKO.1 2582 CDS 100% 13.200 18.480 N CNTN4 n/a
3 TRCN0000222607 GCAGCAAATCTGAACTGGTTA pLKO.1 3300 CDS 100% 4.950 6.930 N CNTN4 n/a
4 TRCN0000073439 CGTGTTTACTTGGTCATTTAA pLKO.1 2755 CDS 100% 15.000 12.000 N CNTN4 n/a
5 TRCN0000371808 GGCCACCTACACCACTAATAT pLKO_005 1788 CDS 100% 15.000 10.500 N CNTN4 n/a
6 TRCN0000419582 AGCAAGGAACACTCAACATAA pLKO_005 2262 CDS 100% 13.200 9.240 N Cntn4 n/a
7 TRCN0000371862 GGATAATGAGTCGGAAGTAAA pLKO_005 3949 CDS 100% 13.200 9.240 N CNTN4 n/a
8 TRCN0000222608 CCGTAACTCAAGGCTGTTGTA pLKO.1 4747 3UTR 100% 4.950 3.465 N CNTN4 n/a
9 TRCN0000073442 CCTGTAATGTTCCCTTTGGAT pLKO.1 1268 CDS 100% 3.000 2.100 N CNTN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13287 pDONR223 100% 67.8% 67.9% None (many diffs) n/a
2 ccsbBroad304_13287 pLX_304 0% 67.8% 67.9% V5 (many diffs) n/a
3 TRCN0000471672 GCGGTGACCCCTCTGTTTCCTGGG pLX_317 19.2% 67.8% 67.9% V5 (many diffs) n/a
Download CSV