Transcript: Human XM_017001617.1

PREDICTED: Homo sapiens Rho guanine nucleotide exchange factor 10 like (ARHGEF10L), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF10L (55160)
Length:
4326
CDS:
124..3831

Additional Resources:

NCBI RefSeq record:
XM_017001617.1
NBCI Gene record:
ARHGEF10L (55160)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427769 CGCATTGACCGGTTCACTTTC pLKO_005 469 CDS 100% 10.800 15.120 N ARHGEF10L n/a
2 TRCN0000427371 AGGTCAGCGTTTCGGACATCA pLKO_005 875 CDS 100% 4.950 6.930 N ARHGEF10L n/a
3 TRCN0000422787 TGGACTCTCCAGAAACTACTT pLKO_005 3930 3UTR 100% 4.950 3.960 N ARHGEF10L n/a
4 TRCN0000431782 GGCGTTTGAGTTTGATGACAG pLKO_005 222 CDS 100% 4.050 3.240 N ARHGEF10L n/a
5 TRCN0000135297 CTGGGTCAACAGGTTACATTT pLKO.1 2226 CDS 100% 13.200 9.240 N ARHGEF10L n/a
6 TRCN0000427337 GTGCTCTGCATGGAGTATATC pLKO_005 2572 CDS 100% 13.200 9.240 N ARHGEF10L n/a
7 TRCN0000428188 AGGTGCCCTTGATGCTATAGC pLKO_005 3812 CDS 100% 4.950 3.465 N ARHGEF10L n/a
8 TRCN0000135135 CCATTAGCTTCATGGTGGTTT pLKO.1 2174 CDS 100% 4.950 3.465 N ARHGEF10L n/a
9 TRCN0000135484 GATGAGGACAAGAAGAGCAAA pLKO.1 2296 CDS 100% 4.950 3.465 N ARHGEF10L n/a
10 TRCN0000135969 GCATCTGCAAGAGATCAACAT pLKO.1 3126 CDS 100% 4.950 3.465 N ARHGEF10L n/a
11 TRCN0000426135 GGAGTCTCTGAAGCGGATACT pLKO_005 1002 CDS 100% 4.950 3.465 N ARHGEF10L n/a
12 TRCN0000426741 AGCGTGACACACATGGTGAAG pLKO_005 3034 CDS 100% 4.050 2.835 N ARHGEF10L n/a
13 TRCN0000416149 GACGGCTCCATTTACGAGATG pLKO_005 3610 CDS 100% 4.050 2.835 N ARHGEF10L n/a
14 TRCN0000137213 GCAGGCTCAGAATAAGGTGTA pLKO.1 1908 CDS 100% 4.050 2.835 N ARHGEF10L n/a
15 TRCN0000433949 TGCTCCTGTGTGAGACGTTGA pLKO_005 1616 CDS 100% 4.050 2.835 N ARHGEF10L n/a
16 TRCN0000137132 CCACAGTTCATACTCCTGCTT pLKO.1 1393 CDS 100% 2.640 1.584 N ARHGEF10L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08479 pDONR223 100% 99.4% 99.5% None (many diffs) n/a
2 ccsbBroad304_08479 pLX_304 0% 99.4% 99.5% V5 (many diffs) n/a
3 TRCN0000468535 TACGAAATTCATTTGACTCCTAGA pLX_317 11.3% 99.4% 99.5% V5 (many diffs) n/a
Download CSV